Human aortic smooth muscle cell regulation by METTL3 via upregulation of m6A NOTCH1 modification and inhibition of NOTCH1
Highlight box
Key findings
• METTL3 regulated the phenotypic changes of HASMC by upregulating m6A modification of NOTCH1 and inhibiting NOTCH1 which provides a reference for further exploring the mechanism of RNA modification in TAD.
What is known and what is new?
• METTL3 is the most famous m6A methyltransferase which plays a role in m6A modified epi-transcriptome modulation and m6A is the most common endogenous chemical RNA modification in mammalian mRNA. NOTCH1 has been confirmed to have an effect on proliferation, apoptosis and differentiation of diseases.
• METTL3 and NOTCH1 m6A modification in HASMC may be related to TAD.
What is the implication, and what should change now?
• This study indicated METTL3 and NOTCH1 m6A modification may play an important role in the pathogenesis of TAD.
• We can research how to prevent and treat TAD by regulation of METTL3 and NOTCH1 m6A modification.
Introduction
Thoracic aortic dissection (TAD) is a major disease that affects the aorta and has a high mortality rate (1). It is an extremely serious vascular condition that must be immediately treated. Common classifications of TAD are the Stanford classification (types A and B) and the DeBakey classification (types I–III), as well as a new auxiliary classification that is intravascular decision-oriented (2). Vascular smooth muscle cell (VSMC) degeneration is one of the main characteristics of TAD (3). Phenotypic conversion of aortic SMCs has been reported as a causal factor for TAD development (4). Clinically, treating this fatal vascular disease requires timely interventional therapy and surgical repair (5). However, TAD treatment remains highly challenging and is progressing rapidly. Therefore, it is necessary to understand the cellular and molecular mechanisms of TAD in order to continue the development of effective prevention and treatment methods.
N6-methyladenosine (m6A) is the most frequent epigenetic modification on eukaryotic messenger RNA (mRNA). It can be modified, demodified, and recognized by a series of methyltransferases, demethylases, and binding proteins to regulate various biological functions by affecting RNA processing and metabolism (6). He et al. (7) found that increased m6A methylation is related to the progression of abdominal aortic aneurysms. The findings also revealed the vital role of m6A regulatory factors, such as YTHDF3, fat mass and obesity associated protein (FTO), and METTL14, in the pathogenesis of abdominal aortic aneurysms in patients. Zhou et al. (8) discussed m6A modification and m6A regulation gene expression in acute aortic dissection (AD). They found that m6A differential methylation and m6A regulation genes, such as METTL14 and FTO, might act on functional genes through RNA modification, which regulate AD pathogenesis (8). However, no existing studies have reported on the relationship between m6A and TAD.
Methyltransferase-like-3 (METTL3) is involved in RNA methylation and plays a key role in catalyzing the formation of m6A (9,10). In bladder cancer, METTL3 promotes bladder cancer progression in an m6A-dependent manner through the AFF4-NF-κB-MYC network (11). Zhong et al. (12) found that METTL3 regulated the occurrence and progression of abdominal aortic aneurysms induced by m6A-dependent primary miR34a. However, although METTL3 and m6A have important functions in various basic biological processes, their roles in TAD remain unclear. NOTCH signaling plays a crucial role in determining cell proliferation, differentiation, and apoptosis (13). In Yi et al.’s (14) study of bladder cancer, they found that changes in m6A methylation level mainly occurred in the 5' untranslated region (5'UTR) of the notch homolog 1 (NOTCH1) transcript, which was related to FTO overexpression. In another study, low METTL3 expression in urinary tumor cells positively regulated the cell death-related pathway NOTCH1 (15). However, there are no studies on the modifying role of METTL3 and NOTCH1 m6A in TAD.
In this study, we explored the METTL3 and NOTCH1 m6A modification mechanisms in human aortic smooth muscle cells (HASMCs) in vitro. Our study intends to provide new insights into the mechanism of RNA modification of TAD in vitro. We present this article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-1203/rc).
Methods
Cell culture and treatment
HASMCs were purchased from iCell (HUM-ICell-A010; Shanghai, China). Cultivation conditions were as follows: Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Gibco), 1% streptomycin, and 1% penicillin in a humidified atmosphere containing 5% CO2 at 37 ℃. METTL3 was knocked down and overexpressed. According to the requirements, HASMCs were divided into the pcDNA3.1 group (HASMCs transfected with pcDNA3.1 plasmids), the pcDNA3.1-METTL3 group (HASMC transfected with plasmids overexpressing pcDNA3.1), the negative small interfering RNA (siRNA) control group (si-NC; HASMCs transfected with NC siRNA), and the si-METTL3 group (HASMCs transfected with METTL3 siRNA). To study the changes of METTL3 and NOTCH1 on the HASMC phenotype, HASMC was cultured and divided into the si-NC group (HASMCs transfected with NC siRNA), the si-METTL3 group (HASMCs transfected with METTL3 siRNA), and the si-METTL3 + si-NOTCH1 group (HASMCs transfected with METTL3 siRNA and NOTCH1 siRNA). pcDNA3.1-METTL3 and the NC pcDNA3.1 were synthesized by GENERAL BIOL (Anhui, China). si-METTL3, si-NOTCH1, and si-NC were synthesized by GenePharma (Shanghai, China). HASMCs were transfected according to the Lipofectamine 2000 manufacturer (BL623B; BioSharp, Tallinn, Estonia) instructions.
Cell Counting Kit-8 (CCK-8) assay
HASMCs in the logarithmic growth phase were rinsed with phosphate-buffered saline (PBS) once and digested by 0.25% trypsin into a single-cell suspension. After digestion was terminated in complete medium, HASMCs were suspended in complete medium. HASMCs were counted, and the cell concentration was adjusted to 3×104 cells/mL and then inoculated into 96-well plates with 100 µL per well (3×103 cells/well). For each group, 3 multiple wells were tested per time point, 100 µL of complete medium was added to each well, and the culture was continued in an incubator with 5% CO2 at 37 ℃. CCK-8 reagent was added after 12, 24, 48, and 72 h (ratio: 1:10). After incubation at 37 ℃ for 2 h, the absorbance values at 450 nm were measured with a microplate reader (Infinite M200, Tecan, Austria).
Quantitative real-time polymerase chain reaction (qRT-PCR)
The expressions of METTL3, METTL3, NOTCH1, α-smooth muscle actin (α-SMA), and smooth muscle protein 22-alpha (SM22α) mRNA were detected after 48 h of transfection. TriQuick Reagent for Total RNA Extraction (R1100; Solarbio, Beijing, China), HiScript III RT SuperMix for qPCR (+gDNA Wiper; R323-01; Vazyme, Nanjing, China), and ChamQ Universal SYBR qPCR Master Mix (Q711-02; Vazyme) were applied for qRT-PCR detection. The relative expression levels of target genes were calculated using the 2−ΔΔCt method. Primer sequences are shown in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene in this study.
Table 1
| Names | Primer | Sequence (5'-3') |
|---|---|---|
| METTL3 | Forward primer | TCACCCCACGAGACCTACTT |
| Reverse primer | GAAAGCCTTCCCCACAATGG | |
| α-SMA | Forward primer | ACTGCCTTGGTGTGTGACAA |
| Reverse primer | CACCATCACCCCCTGATGTC | |
| SM22α | Forward primer | CCTTCCTATGGCATGAGCCG |
| Reverse primer | ATCACGCCATTCTTCAGCCA | |
| Calponin | Forward primer | AGGTTAAGAACAAGCTGGCCC |
| Reverse primer | TTTGAGGCCGTCCATGAAGT | |
| NOTCH1 | Forward primer | GGACGTCAGACTTGGCTCAG |
| Reverse primer | ACATCTTGGGACGCATCTGG | |
| GAPDH | Forward primer | GAGTCAACGGATTTGGTCGT |
| Reverse primer | GACAAGCTTCCCGTTCTCAG |
METTL3, methyltransferase like 3; α-SMA, α-smooth muscle actin; SM22α, smooth muscle protein 22-alpha; NOTCH1, notch homolog 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Western blot
Western blot was used to analyze the METTL3, NOTCH1, α-SMA, SM22α, and calponin protein expressions after 48 h of transfection. The total protein was extracted from HASMCs using RIPA lysis buffer. Proteins were quantified for each group according to with a bicinchoninic acid (BCA) protein determination kit (BL521A; BioSharp). SDS-PAGE loading buffer was mixed with the mixture, and the mixture was heated in a boiling water bath at 100 ℃ for 5 min. The protein was adsorbed on a polyvinylidene fluoride (PVDF) membrane by gel electrophoresis and sealed with a 5% skim milk solution for 90 min at room temperature. The anti-METTL3 antibody (EPR18810; dilution: 1:1,000; ab195352; Abcam, Cambridge, UK), anti-α-SMA antibody (dilution: 1:10,000; ab5694; Abcam), anti-TAGLN/transgelin antibody (dilution: 1:5,000; ab14106; Abcam), anti-calponin 1 antibody (EP798Y; dilution: 1:5,000; ab46794; Abcam), anti-Notch1 antibody (EP1238Y; dilution: 1:2,000; ab52627; Abcam), and GAPDH (dilution: 1:5,000; ab9485; Abcam) were incubated overnight. We then incubated the horseradish peroxidase (HRP)-labeled secondary antibody immunoglobin G (IgG)-HRP (dilution: 1:2,000; BL003A; BioSharp). Exposure was performed using an ultra-sensitive electrochemiluminescence (ECL) substrate (BL520A; BioSharp). GAPDH was used as an internal reference.
m6A dot blot assay
After 48 h of transfection, changes in the m6A modification level were detected according to a previously described method (16). Total RNA was separated as described above, and then mRNA was extracted using the PolyATtract mRNA Isolation Systems (Promega Corporation, Madison, WI, USA). The isolated mRNA was heated at 95 ℃ for 3 min to desaturate and unfreeze it. The isolated mRNA (300 ng) was spotted on Amersham Hybond-N (GE Healthcare, Chicago, IL, USA), and the membrane was optimized for nucleic acid transfer. Then, the mRNA was diplomatically linked in ultraviolet products. It was then stained with 0.02% methylene blue (Sangon Biotech, Shanghai, China). We scanned the blue dots to show the input RNA content. The membranes were washed with tris-buffered saline tween (TBST) buffer, sealed with 5% skim milk, and incubated overnight with anti-m6A antibodies (dilution: 1:1,000; ab208577; Abcam) at 4 ℃. After incubation of the second antibody, the membranes were observed using Immobilon Western Chemilum HRP Substrate (MilliporeSigma, Burlington, MA, USA).
Methylated RNA immunoprecipitation (MeRIP) assay
HASMCs were transfected with METTL3-overexpressing plasmids, and METTL3 antibody was used for the RNA immunoprecipitation (RIP) test after 48 h of transfection. NOTCH1 mRNA expression was measured using qRT-PCR. TRIzol was used to extract total RNA from cells, and the MeRIP kit (MilliporeSigma) was used according to the instructions. A total of 25 µg of mRNA was heated and broken into 100 nt RNA fragments, which were then incubated with a specific m6A antibody (5 µg per sample) for 2 h. Protein A/G magnetic beads were added to coprecipitate, and the antibody-bound RNA fragments were purified. The immunoprecipitated RNA was reverse-transcribed into complement DNA (cDNA). Then, qRT-PCR amplification was performed with the cDNA template. Dissolution curves of amplified PCR products were analyzed. Finally, Abi Prism 7300 SDS Software (Themo Fisher Scientific, Waltham, MA, USA) was used for data analysis.
Bioinformatics prediction and dual-luciferase reporter gene assay
The NOTCH1 3'UTR m6A modification was analyzed using SRAMP and RMBase v. 2.0. A total of 293 T cells were cultured and divided into the pmirGLO + pcDNA3.1, pmirGLO + pcDNA3.1-METTL3, wild type 1 (WT1; sequence of NOTCH1: GGTAGAAACTTTTAT) + pcDNA3.1, WT1 + pcDNA3.1-METTL3, mutant type 1 (mut1; NOTCH1 sequence: GGTAGAATCTTTTAT) + pcDNA3.1, mut1 + pcDNA3.1-METTL3, WT2 (NOTCH1 sequence: TGTGTGGACTGTGGC) + pcDNA3.1, WT2 + pcDNA3.1-METTL3, mut2 (NOTCH1 sequence: TGTGTGGTCTGTGGC) + pcDNA3.1, and mut2 + pcDNA3.1-METTL3 groups. The fluorescent reporter plasmids were synthesized by GENERAL BIOL. After 48 h of transfection, luciferase activity was evaluated according to the instructions of the luciferase activity kit (FR201, TransGen Biotech, Beijing, China).
RNA RIP assay
HASMCs were transfected with METTL3-overexpressing plasmids, and YTH domain family 2 (YTHDF2) antibody was used for the RIP test after 48 h of transfection. NOTCH1 mRNA expression was determined using qRT-PCR. The RIP experiment was performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (#17-700; MilliporeSigma). Complete RIP lysis buffer was used to lysate cells, and the supernatant was collected after centrifugation to prepare cell lysate. The antibody was incubated with magnetic beads to prepare immunoprecipitation magnetic beads. Subsequently, the cell lysates were incubated with immunoprecipitation magnetic pellets as required by the kit. We used anti-YTHDF2 antibody (EPR23544-19; dilution: 1:30; AB246514; Abcam) to immunoprecipitate the RNA-binding protein-RNA complex. The RNA was eluted and purified for qRT-PCR detection.
Statistical analysis
GraphPad Prism 8.0 (GraphPad Software, Inc., San Diego, CA, USA) was used for statistical analysis. Data are expressed as mean ± standard deviation. The Student t-test was used to analyze differences between the two groups, and one-way analysis of variance (ANOVA) was used to compare data differences between multiple groups. A P value less than 0.05 was considered statistically significant. The experiment was replicated in the laboratory 3 times.
Results
The effect of METTL3 expression on HASMC phenotype
First, METTL3 was knocked down and overexpressed. As shown in Figure 1A, METTL3 expression increased after overexpression of METTL3, and METTL3 expression decreased after METTL3 interference. These results indicated successful interference and overexpression of METTL3 in HASMCs. Next, smooth muscle markers α-SMA, SM22α, and calponin expressions were detected. Overexpression of METTL3 could inhibit α-SMA, SM22α, and calponin expressions, while knocking down METTL3 promoted α-SMA, SM22α, and calponin expressions (Figure 1B). In addition, we found that overexpression of METTL3 promoted HASMC proliferation, and knocking down METTL3 inhibited HASMC proliferation (Figure 1C). Finally, the m6A dot blot assay measured changes in the total m6A modification levels after overexpression and interference with METTL3. The results showed that the m6A modification level was significantly increased after overexpression of METTL3, and knocking down significantly decreased the METTL3 m6A modification level (Figure 1D).
The effect of METTL3 expression on NOTCH1 expression
Subsequently, NOTCH1 expression was detected after overexpressing and knocking down METTL3 in HASMCs. The qRT-PCR results suggested that NOTCH1 expression was lower in the pcDNA3.1-METTL3 group compared with the pcDNA3.1 group. Compared with the si-NC group, NOTCH1 expression was higher in the si-METTL3 group (Figure 2A). The tendency shown by the western blot results was consistent with that of the qRT-PCR results (Figure 2B). These results indicated that METTL3 overexpression could inhibit NOTCH1 expression, while METTL3 inhibition promoted NOTCH1 expression.
METTL3 regulated NOTCH1 to participate in HASMC phenotypic changes
To study the effects of METTL3 and NOTCH1 on HASMC phenotype, we knocked down both METTL3 and NOTCH1. First, we examined interference efficiency. qRT-PCR results showed that, compared with the si-NC group, METTL3 expression was lower and NOTCH1 expression was higher in the si-METTL3 group. After further knocking down NOTCH1, NOTCH1 expression decreased (Figure 3A). This result indicated successful interference with METTL3 and NOTCH1 in HASMC. The western blot further verified the interference efficiency (Figure 3B). Next, we investigated the expression of smooth muscle markers α-SMA, SM22α, and calponin. As shown in Figure 3A,3B, knocking down NOTCH1 inhibited the promoting effects of METTL3 interference on α-SMA, SM22α, and calponin. CCK-8 results showed that knocking down NOTCH1 could upregulate the reduced HASMC proliferation caused by knocking down METTL3 (Figure 3C). Finally, changes in total m6A modification levels were detected. As shown in Figure 3D, knocking down NOTCH1 could upregulate the reduction of the m6A modification level caused by knocking down METTL3. These results demonstrated that METTL3 regulated NOTCH1 to contribute to HASMC phenotypic changes, including the proliferation ability and the expression of α-SMA, SM22α, and calponin.
METTL3 promoted NOTCH1 3'UTR m6A modification to recruit YTHDF2
As shown in Figure 4A, we first examined the possibility that METTL3 regulated NOTCH1 3'UTR m6A modification using SRAMP and RMBase v. 2.0. Results indicated that METTL3 could regulate NOTCH1 3'UTR m6A modification (Figure 4A). Next, MeRIP assay was used to detect NOTCH1 mRNA expression after METTL3 overexpression to verify the prediction outlined in Figure 4A. Compared with the pcDNA3.1 group, the m6A modification level of NOTCH1 mRNA in the pcDNA3.1-METTL3 group was higher (Figure 4B). Dual-luciferase assay indicated that the NOTCH1 mRNA m6A modification site and overexpression of METTL3 promoted NOTCH1 mRNA degradation (Figure 4C). YTHDF2-RIP further demonstrated the binding ability of YTHDF2, and NOTCH1 mRNA was enhanced after METTL3 overexpression (Figure 4D). These results indicated that METTL3 promoted the recruitment of YTHDF2 by NOTCH1 3'UTR m6A modification.
Discussion
Despite decades of research on TAD, the factors affecting its development and the deeper regulatory mechanism are still poorly understood. RNA modification plays an essential role in many biological processes, such as gene expression regulation, and m6A is a reversible and widely conserved RNA methylation in eukaryotes (17). Genetic variations affecting RNA modification may play a functional role in TAD. In this study, we investigated the modifying role of METTL3 and NOTCH1 m6A in HASMCs in vitro. We found that METTL3 regulated the phenotypic changes of HASMC by upregulating NOTCH1 m6A modification and inhibiting NOTCH1. This is the first study to report METTL3 and NOTCH1 m6A modification in HASMCs.
VSMCs have contractile and synthetic functions, which are related to and characterized by changes in morphology, proliferation, mobility, and expression of different marker proteins (18). In healthy arteries, most media VSMCs maintain a contractile phenotype, which enables them to regulate vascular tone and maintain hemodynamic balance (19). The abnormal proliferation and migration of VSMCs destroy vascular system stability and are the main factor leading to pathological vascular remodeling (20). The phenotypic transformation of VSMCs in the aortic medium might play a vital role in TAD pathogenesis (3). Phenotypic transformation is known as a dedifferentiation process. These dedifferentiated or synthetic VSMCs are characterized by decreased α-SMA, SM22α, and calponin expressions and increased proliferation and migration (19,21). In this study, we found that overexpression of METTL3 inhibited the expression of smooth muscle markers α-SMA, SM22α, and calponin and promoted HASMC proliferation.
METTL3 is the most well-known m6A methyltransferase, and it plays a role in m6A-modified epi-transcriptome modulation (22). m6A is the most common endogenous chemical RNA modification in mammalian mRNA. m6A modification affects many aspects of RNA metabolism, from RNA processing and nuclear output to RNA translation and decay (23). Zhou et al. (8) found that the m6A level in total RNA significantly increased in patients with acute AD. Our study found that the m6A modification level was significantly increased after METTL3 overexpression, while knocking down METTL3 significantly decreased the m6A modification level. One study reported that METTL3-mediated m6A mRNA modification promoted esophageal cancer occurrence and progression through the NOTCH pathway (24). In a study of non-small cell lung cancer, circNOTCH1 was competently bound with METTL14 to protect NOTCH1 mRNA (25). We found that overexpression of METTL3 inhibited NOTCH1 expression, while knocking down METTL3 promoted NOTCH1 expression. In addition, MeRIP assay showed that the NOTCH1 mRNA m6A modification level was increased after METTL3 overexpression. Dual-luciferase assay indicated that the NOTCH1 mRNA m6A modification site and METTL3 overexpression promoted NOTCH1 mRNA degradation. These results indicate that METTL3 and NOTCH1 m6A modification plays a critical regulatory role in HASMCs.
NOTCH1 has been confirmed to have an effect on the proliferation, apoptosis, and differentiation of diseases (26). Wang et al. (27) reported that the m6A methyl transfer enzyme METTL3 could also affect the cerebral arteriovenous malformation phenotype by regulating the NOTCH pathway. Our results from cointerfering with METTL3 and NOTCH1 in HASMCs showed that knocking down NOTCH1 could upregulate the reduction of the m6A modification level caused by knocking down METTL3. METTL3 regulated NOTCH1 to exert changes in the HASMC phenotype. These results provide in vitro experimental evidence for the role of m6A regulator-target axes in TAD. YTHDF2 is an m6A binding protein that promotes mRNA degradation in various biological processes (28). It has been reported that YTHDF2 inhibited NOTCH signaling by posttranscriptional regulation of NOTCH1 (29). In hypoxic pulmonary hypertension, YTHDF2 was found to recognize METTL3-mediated m6A to modify PTEN mRNA and promoted PTEN degradation (30). Using YTHDF2-RIP, our study demonstrated that the binding ability of YTHDF2 and NOTCH1 mRNA is enhanced after METTL3 overexpression. However, our research still lacks experimental depth, and further investigation into the relevant mechanisms is needed in the future.
Conclusions
Our study suggests that METTL3 regulates the phenotypic changes of HASMCs by upregulating the m6A modification of NOTCH1 and inhibiting NOTCH1. METTL3 and NOTCH1 m6A modifications in HASMCs are reported here for the first time. This study provides a reference to further explore the mechanisms of RNA modification in TAD.
Acknowledgments
Funding: The study was supported by
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-1203/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-1203/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-1203/coif). ZL is a researcher in Forevergen Biosciences Center. The other authors have no conflicts of interest to declare.
Ethical Statement:
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Takada M, Yamagishi K, Tamakoshi A, et al. Height and Mortality from Aortic Aneurysm and Dissection. J Atheroscler Thromb 2022;29:1166-75. [Crossref] [PubMed]
- Saremi F, Hassani C, Lin LM, et al. Image Predictors of Treatment Outcome after Thoracic Aortic Dissection Repair. Radiographics 2018;38:1949-72. [Crossref] [PubMed]
- Zhang S, Zhao S, Han X, et al. Lnc-C2orf63-4-1 Confers VSMC Homeostasis and Prevents Aortic Dissection Formation via STAT3 Interaction. Front Cell Dev Biol 2021;9:792051. [Crossref] [PubMed]
- Pan L, Bai P, Weng X, et al. Legumain Is an Endogenous Modulator of Integrin αvβ3 Triggering Vascular Degeneration, Dissection, and Rupture. Circulation 2022;145:659-74. [Crossref] [PubMed]
- Qiu L, Yi S, Yu T, et al. Sirt3 Protects Against Thoracic Aortic Dissection Formation by Reducing Reactive Oxygen Species, Vascular Inflammation, and Apoptosis of Smooth Muscle Cells. Front Cardiovasc Med 2021;8:675647. [Crossref] [PubMed]
- Huang H, Weng H, Chen J. m(6)A Modification in Coding and Non-coding RNAs: Roles and Therapeutic Implications in Cancer. Cancer Cell 2020;37:270-88. [Crossref] [PubMed]
- He Y, Xing J, Wang S, et al. Increased m6A methylation level is associated with the progression of human abdominal aortic aneurysm. Ann Transl Med 2019;7:797. [Crossref] [PubMed]
- Zhou X, Chen Z, Zhou J, et al. Transcriptome and N6-Methyladenosine RNA Methylome Analyses in Aortic Dissection and Normal Human Aorta. Front Cardiovasc Med 2021;8:627380. [Crossref] [PubMed]
- Xia T, Wu X, Cao M, et al. The RNA m6A methyltransferase METTL3 promotes pancreatic cancer cell proliferation and invasion. Pathol Res Pract 2019;215:152666. [Crossref] [PubMed]
- He Y, Wang W, Xu X, et al. Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through mediating Bcl2 stability via Ythdf1-mediated m(6)A modification. Bone 2022;154:116182. [Crossref] [PubMed]
- Cheng M, Sheng L, Gao Q, et al. The m(6)A methyltransferase METTL3 promotes bladder cancer progression via AFF4/NF-κB/MYC signaling network. Oncogene 2019;38:3667-80. [Crossref] [PubMed]
- Zhong L, He X, Song H, et al. METTL3 Induces AAA Development and Progression by Modulating N6-Methyladenosine-Dependent Primary miR34a Processing. Mol Ther Nucleic Acids 2020;21:394-411. [Crossref] [PubMed]
- Guo S, Quan S, Zou S. Roles of the Notch Signaling Pathway in Ovarian Functioning. Reprod Sci 2021;28:2770-8. [Crossref] [PubMed]
- Yi W, Yu Y, Li Y, et al. The tumor-suppressive effects of alpha-ketoglutarate-dependent dioxygenase FTO via N6-methyladenosine RNA methylation on bladder cancer patients. Bioengineered 2021;12:5323-33. [Crossref] [PubMed]
- Tao Z, Zhao Y, Chen X. Role of methyltransferase-like enzyme 3 and methyltransferase-like enzyme 14 in urological cancers. PeerJ 2020;8:e9589. [Crossref] [PubMed]
- Jia G, Fu Y, Zhao X, et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 2011;7:885-7. [Crossref] [PubMed]
- Chai T, Tian M, Yang X, et al. Genome-Wide Identification of RNA Modifications for Spontaneous Coronary Aortic Dissection. Front Genet 2021;12:696562. [Crossref] [PubMed]
- Green ID, Liu R, Wong JJL. The Expanding Role of Alternative Splicing in Vascular Smooth Muscle Cell Plasticity. Int J Mol Sci 2021;22:10213. [Crossref] [PubMed]
- Furmanik M, Chatrou M, van Gorp R, et al. Reactive Oxygen-Forming Nox5 Links Vascular Smooth Muscle Cell Phenotypic Switching and Extracellular Vesicle-Mediated Vascular Calcification. Circ Res 2020;127:911-27. [Crossref] [PubMed]
- Huang W, Huang C, Ding H, et al. Involvement of miR-145 in the development of aortic dissection via inducing proliferation, migration, and apoptosis of vascular smooth muscle cells. J Clin Lab Anal 2020;34:e23028. [Crossref] [PubMed]
- Ding H, Pan Q, Qian L, et al. Differentially expressed mRNAs and their upstream miR-491-5p in patients with coronary atherosclerosis as well as the function of miR-491-5p in vascular smooth muscle cells. Korean J Physiol Pharmacol 2022;26:183-93. [Crossref] [PubMed]
- Liu S, Zhuo L, Wang J, et al. METTL3 plays multiple functions in biological processes. Am J Cancer Res 2020;10:1631-46. [PubMed]
- Sun T, Wu R, Ming L. The role of m6A RNA methylation in cancer. Biomed Pharmacother 2019;112:108613. [Crossref] [PubMed]
- Han H, Yang C, Zhang S, et al. METTL3-mediated m(6)A mRNA modification promotes esophageal cancer initiation and progression via Notch signaling pathway. Mol Ther Nucleic Acids 2021;26:333-46. [Crossref] [PubMed]
- Shen Y, Li C, Zhou L, et al. G protein-coupled oestrogen receptor promotes cell growth of non-small cell lung cancer cells via YAP1/QKI/circNOTCH1/m6A methylated NOTCH1 signalling. J Cell Mol Med 2021;25:284-96. [Crossref] [PubMed]
- Zeronian MR, Klykov O, Portell I, de Montserrat J, et al. Notch-Jagged signaling complex defined by an interaction mosaic. Proc Natl Acad Sci U S A 2021;118:e2102502118. [Crossref] [PubMed]
- Wang LJ, Xue Y, Huo R, et al. N6-methyladenosine methyltransferase METTL3 affects the phenotype of cerebral arteriovenous malformation via modulating Notch signaling pathway. J Biomed Sci 2020;27:62. [Crossref] [PubMed]
- Dixit D, Prager BC, Gimple RC, et al. The RNA m6A Reader YTHDF2 Maintains Oncogene Expression and Is a Targetable Dependency in Glioblastoma Stem Cells. Cancer Discov 2021;11:480-99. [Crossref] [PubMed]
- Lee B, Lee S, Shim J. YTHDF2 Suppresses Notch Signaling through Post-transcriptional Regulation on Notch1. Int J Biol Sci 2021;17:3776-85. [Crossref] [PubMed]
- Qin Y, Qiao Y, Li L, et al. The m(6)A methyltransferase METTL3 promotes hypoxic pulmonary arterial hypertension. Life Sci 2021;274:119366. [Crossref] [PubMed]

