LncRNA RASSF8-AS1 knockdown displayed antiproliferative and proapoptotic effects through miR-188-3p/ATG7 pathway in ox-LDL-treated vascular smooth muscle cells
Highlight box
Key findings
• The up-regulation of RASSF8-AS1 in peripheral blood could be used as a diagnostic marker for AS patients.
• RASSF8-AS1 directly elevated ATG7 expression through sponging miR-188-3p in ox-LDL-treated HA-VSMCs.
• RASSF8-AS1 potentiated proliferation and anti-apoptosis of VSMCs-treated by ox-LDL in AS by regulating miR-188-3p/ATG7-mediated autophagy pathway.
What is known and what is new?
• LncRNA plays an important role in the development of AS.
• We identified a novel lncRNA RASSF8-AS1 involved in AS progression and elucidated that RASSF8-AS1 directly promoted ATG7-mediated autophagy through sponging miR-188-3p.
What is the implication, and what should change now?
• Our data confirmed that a novel RASSF8-AS1/miR-188-3p/ATG7-mediated autophagy pathway regulated the biological function of VSMCs in AS, suggesting that this pathway could be used as diagnostic tools and novel therapeutic strategies of AS. However, the above signaling pathways need to be further verified by various animal experiments in the future.
Introduction
Atherosclerosis (AS), which refers to the formation of fibrofatty lesions in the innermost layer of arteries, is the most main underlying pathology of coronary artery disease (1). AS mainly causes cardiovascular diseases, such as stroke, myocardial infarction, and disabling peripheral artery disease, and is a significant cause of death worldwide (2). Low-density lipoprotein (LDL) is a particle that transports cholesterol through the bloodstream and is necessary for the generation of atherosclerotic lesions (2). A growing body of evidence points to the presence of other risk factors, including diabetes mellitus, hypertension, inflammation, clonal hematopoiesis, and cigarette smoking (3). AS is a diffuse and slowly progressive disease that can involve multiple arterial beds (2). Its slow progression leads to the asymptomatic phenotype that can last for decades (2). The clinical presentation of AS involves carotid and cerebral arteries, thoracic aorta, renal arteries, superior and inferior mesenteric arteries, coronary arteries, abdominal aorta, and peripheral arteries (1). A study of the cells and molecules involved in the AS process have advanced the understanding of the link between the risk factors, atheroma development, and clinical manifestations of AS (4).
As the main cell type in the pre-AS intima, smooth muscle cells (SMCs) appear with diffuse intimal thickening and AS plaque generation (5). The phenotype of SMCs changes in response to extracellular lipids and lipoproteins (6). With the development of AS plaque, intimal SMCs exhibit a high proliferative rate, loss of contractility, and an elevated level of proteoglycans (6,7).
Long noncoding RNAs (lncRNAs) with 200 nucleotides can regulate phenotypic effects via their capacity to target DNA, microRNA (miRNA), RNA-binding proteins, and proteins (8-11). Research has discovered that lncRNA expression is altered in the intima of AS lesions (12,13). Macrophage-specific lncRNA MAARS increases 270-fold in the aortic intima with the progression of AS (12), while aortic intimal expression of lncRNA VINAS decreases with AS progression (13). LncRNAs are increasingly considered as significant modulators of the pathophysiological processes of AS (12,13). It has been confirmed that lncRNA MAARS is involved in apoptosis via the regulation of caspase-9, p27, p53, and BCL2 based on the interaction with HuR/ELAVL1 (12). One loss-of-function study proved that lncRNA VINAS mediating the NF-κB and MAPK signaling pathways regulates vascular inflammation (13). In addition, it has been demonstrated that lncRNA-TCONS_00034812 is significantly up-regulated in arterial tissue samples of AS patients, and lncRNA-TCONS_00034812 promotes human aortic smooth muscle cells proliferation by up-regulating miR-21 (14). Tao et al. reported that lncRNA SOX2-OT was outstandingly upregulated in patients with carotid AS, which might be an independent prognostic biomarker for the progression of carotid AS (15). Guo et al. demonstrated that lncRNA-FA2H-2 interacted with the promoter of the MLKL gene to lead to the downregulated MLKL, thereby activating inflammation and inhibiting autophagic flow, which in turn aggravates AS (16). Wang et al. indicated that lncRNA SNHG16 aggravated atherosclerotic plaque formation and increased ox-LDL-activated vascular smooth muscle cells (VSMCs) growth by upregulating HMGB2 expression via sponging miRNA-22-3p (17). Accumulating evidence have indicated that lncRNAs exert critical roles in AS progression, but their functional roles and regulatory mechanisms remain unclear.
In this study, bioinformatics and quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) analysis confirmed that the upregulation of lncRNA RASSF8-AS1 (RASSF8-AS1) in AS can be used as a diagnostic marker for AS, suggesting that RASSF8-AS1 may be a potential lncRNA associated with AS development. Furthermore, ox-LDL stimulation was used to construct an AS cell model in order to confirm the effect of RASSF8-AS1 on the biological function of human aortic vascular smooth muscle cells (HA-VSMCs). Moreover, previous studies have revealed the crosstalk between the biogenesis of proteins and lncRNA-mediated processing of miRNAs in AS (18,19). Hence, we also analyzed the pathogenesis of AS from the perspective of lncRNA-miRNA-messenger RNA (mRNA) axis, and we identified a novel lncRNA RASSF8-AS1 directly promoted ATG7-mediated autophagy and proliferation of HA-VSMCs through sponging miR-188-3p. these founding suggested that novel RASSF8-AS1/miR-188-3p/ATG7-mediated autophagy pathway could be used as diagnostic tools and novel therapeutic strategies of AS. We present the following article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-6457/rc).
Methods
Data extraction and bioinformatical analysis
Transcriptomic profiles of lncRNAs in patients with AS from the Gene Expression Omnibus (GEO) database under the accession number GSE146882 (http://www.ncbi.nlm.nih.gov/geo/) were obtained. The expression of lncRNAs was normalized, and log2 transformation was applied for each matrix. lncRNAs with significant differences between AS patients and healthy individuals were screened with |log(fold change)| more than 1.5 and P values less than 0.05. The target genes of miR-188-3p were predicted using miRWalk (http://mirwalk.umm.uni-heidelberg.de/).
Sample collection
This study enrolled 20 patients with AS but no history of treatment and 21 healthy individuals. The clinical features of patients with AS and healthy participants are summarized in Table 1. Peripheral blood (10 mL) was collected for gene expression analysis. The clinical parameters are shown in Table 1 and include LDL cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C). The inclusion criteria for healthy individuals were as follows: no AS symptoms, malignant and inflammatory diseases, autoimmune diseases, or infections within the previous 1 month. All participants who participated in this study signed an informed consent form, and this study was approved by the Ethics Committee of the First Affiliated Hospital of Guangdong Pharmaceutical University (No. 202112). The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
Table 1
| Variables | Normal (n=21) | AS (n=20) | P value |
|---|---|---|---|
| Males/females (n) | 9/12 | 9/11 | – |
| Age (years) | 58±5 | 63±11 | 0.05 |
| Body mass index (kg/m2) | 22.05±5.99 | 24.11±3.25 | 0.25 |
| Current smokers | – | 6 (30.0) | – |
| Hypertension | – | 15 (75.0) | – |
| Diabetes mellitus | – | 7 (35.0) | – |
| Total cholesterol (mmol/L) | 4.44±0.97 | 4.80±0.99 | 0.06 |
| Triglyceride (mmol/L) | 0.96±0.31 | 1.33±0.78 | 0.3 |
| HDL-C (mmol/L) | 1.46±0.0.30 | 1.27±0.31 | 0.07 |
| LDL-C (mmol/L) | 2.08±0.67 | 2.93±1.00 | 3.00E-03 |
Data are shown as n (%) or mean ± SD. AS, atherosclerosis; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol.
Cell culture and treatment
HA-VSMCs were provided by the American Type Culture Collection (ATCC; Rockville, MD, USA). HA-VSMCs were maintained in SMC medium (SMCM; ScienCell, Carlsbad, CA, USA) and cultured in an incubator containing 5% CO2 at 37 ℃. HA-VSMCs were passaged every 3–4 days. The medium was added with 1% penicillin-streptomycin and 2% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). HA-VSMCs were incubated for 24 h. Oxidized LDL (ox-LDL) was prepared at concentrations of 25, 50, 75, and 100 µg/mL.
Cell transfection
The short-hairpin RNA targeting RASSF8-AS1 (sh-lncRNA#1, sh-lncRNA#2, and sh-lncRNA#3) and corresponding negative control (sh-NC) were designed and generated by GenePharma (Shanghai, China). To construct the vectors overexpressing RASSF8-AS1 or ATG7. The full-length sequence of RASSF8-AS1 or ATG7 mRNA was synthesized and constructed into the pcDNA3.1 vector (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA). For the NC, the cells were transfected with the empty pcDNA3.1 vector. miR-188-3p inhibitor and NC inhibitor, and miR-188-3p mimic and NC mimic were obtained from GenePharma. The transfection was implemented with Lipofectamine 3000 (Invitrogen) in accordance with manufacturer protocol. The sequences of RASSF8-AS1 short hairpin RNAs (shRNAs), miR-188-3p mimics/inhibitor, NC mimic, and NC inhibitor are provided in Table 2.
Table 2
| Item | Sequence (5'-3') |
|---|---|
| RASSF8-AS1 shRNA#1 | CCGGCAGTTGTGACTATATTCTACTCGAGTAGAATAT |
| AGTCACAACTGTTTTTG | |
| RASSF8-AS1 shRNA#2 | CCGGGATTGTCAATGAATCAGAACTCGAGTTCTGAT |
| TCATTGACAATCTTTTTG | |
| RASSF8-AS1 shRNA#3 | CCGGGGACCATAAGAAAGTGAAACTCGAGTTTCAC |
| TTTCTTATGGTCCTTTTTG | |
| NC shRNA | CCGGTCCTAAGGTTAAGTCGCCCTCGCTCGAGCGA |
| GGGCGACTTAACCTTAGGTTTTTG | |
| miR-188-3p mimics | CUCCCACAUGCAGGGUUUGCA |
| NC mimics | UUGUACUACACAAAAGUACUG |
| miR-188-3p inhibitor | UGCAAACCCUGCAUGUGGGAG |
| NC inhibitor | CAGUACUUUUGUGUAGUACAA |
shRNA, short hairpin RNA; NC, negative control.
Cell viability
HA-VSMCs were seeded into 96-well plates at 5×103 cells each well and precultured overnight. Cell viability of HA-VSMCs was assayed using Cell Counting Kit-8 (CCK-8). After 24 h of intervention with ox-LDL, the medium was replaced with 100 µL of fresh medium supplemented with CCK-8 reagent (10 µL; Beyotime, Shanghai, China). After 4 h of incubation, the supernatants were discarded. Next, 200 µL of dimethyl sulfoxide was added to each well in the 96-well plate. A microplate reader (Thermo Fisher Scientific) was used to detect the optical value at 450 nm.
Apoptosis assay
HA-VSMCs were collected in pre-cooled phosphate-buffered saline (PBS) and then dissociated by trypsinization. The cells were harvested by centrifugation (3,000 r/min, 5 min) and resuspended in binding buffer (1×). Then, 100 µL of HA-VSMCs were incubated into 96-well plates (1×105 cells each well). After supplementation with Annexin V-conjugated fluorescein isothiocyanate (FITC; 5 µL) and propidium iodide (PI; 5 µL; Sigma-Aldrich, St. Louis, MO, USA), the cells were incubated for 15 min in the dark at room temperature. Next, binding buffer (1×; 400 µL) was added into the culture. Flow cytometry (Becton Dickinson, San Jose, CA, USA) was used to detect apoptotic cells.
Dual-luciferase reporter assay
The RASSF8-AS1 sequence or the ATG7 3' untranslated region (3'-UTR) sequence harboring the predicted binding sites of miR-188-3p [RASSF8-AS1-wild type (WT) or ATG7-WT] or designed mutant binding sites [RASSF8-AS1-mutant (MUT) or ATG7-MUT] were inserted into pmirGLO reporter vectors (Promega, Madison, WI, USA), respectively. For luciferase reporter assays, the vectors and miR-188-3p mimics or NC mimics were co-transfected into HA-VSMCs. HA-VSMCs were incubated for 48 h before luciferase assay. Then, the Dual-Luciferase Reporter System (Promega) was used to detect luciferase activity after 48 h of transfection. The relative expression of the luciferase reporter was analyzed by the ratio of firefly and Renilla luciferase signals.
qRT-PCR
Total RNA was isolated from HA-VSMCs using MagMAX mirVana Total RNA Isolation Kit (Thermo Fisher Scientific). For ATG7 and RASSF8-AS1, complement DNA (cDNA) was generated using PrimeScript RT Master Mix Kit (Takara, Dalian, China). SYBR Premix Ex Taq Kit (Takara Bio) was used for qRT-PCR. The reaction was performed on a Bio-Rad IQ5 qPCR system (Bio-Rad Laboratories, Hercules, CA, USA). ATG7 and RASSF8-AS1 expression was normalized to GAPDH. TaqMan MicroRNA Assay and TaqMan Universal PCR Master Mix (Thermo Fisher Scientific) were used for the amplification of miR-188-3p. miR-188-3p expression was normalized to U6. qRT-PCR was carried out with the specific primers for RASSF8-AS1, miR-188-3p, and ATG7 (Table 3). Relative quantification of RASSF8-AS1, miR-188-3p, and ATG7 was based on the 2-∆∆CT formula.
Table 3
| Item | Sequence (5'-3') |
|---|---|
| RASSF8-AS1 | Forward primer, GGTATGTGGTGCTGGCAGGAAT |
| Reverse primer, AGAGGTGGAAAGACGGGTGAGA | |
| miR-188-3p | RT primer, 5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGCAAAC-3' |
| Forward primer, GCAATATTACTCCCACATGCAGG | |
| Reverse primer, GTCGTATCCAGTGCGTGTC | |
| ATG7 | Forward primer, CGTCACCGAGAGCCTCTTATG |
| Reverse primer, AATCACCACTGGCTGAGAACC | |
| U6 | RT primer, AAAATATGGAACGCTTCACGAATTTG |
| Forward primer, CTCGCTTCGGCAGCACATATACT | |
| Reverse primer, ACGCTTCACGAATTTGCGTGTC | |
| GAPDH | Forward primer, AAGTATGACAACAGCCTCAAG |
| Reverse primer, TCCACGATACCAAAGTTGTC |
qRT-PCR, quantitative real-time reverse-transcription polymerase chain reaction; RT, reverse transcription.
Western blot analysis
HA-VSMCs cells were washed in PBS, lysed with the pre-cooled RIPA buffer (including protease inhibitor cocktail), and collected by centrifugation (12,000 r/mim; 10 min; 4 ℃). The pellets were collected in the mixture of 0.125 Tris-hydrochloride, 20% sodium dodecyl sulfate (SDS), 10% glycine, and 2-mercaptoethanol. After being separated by 10% SDS-polyacrylamide gel electrophoresis, the proteins were blotted onto polyvinylidene fluoride (PVDF) membranes (Roche, Switzerland), blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween20 (TBST), maintained at 4 ℃ overnight, washed with TBST buffer, probed with primary antibodies, and co-incubated with horseradish peroxidase-conjugated secondary antibodies for 2 h at 25 ℃. The enhanced chemiluminescence (Thermo Fisher Scientific) and ImageJ software (National Institutes of Health, Bethesda, MD, USA) were used for protein visualization and quantification. β-actin was selected for normalization.
Statistical analysis
Values are presented as the mean ± standard error of the mean. GraphPad Prism (GraphPad Software, La Jolla, CA, USA) was used for the statistical analysis. The receiver operating characteristic (ROC) curve was used to measure the diagnostic power of RASSF8-AS1 and miR-188-3p transcript levels for categorizing patients. The correlations of RASSF8-AS1 expression with LDL-C level and miR-188-3p expression were evaluated by Spearman rank correlation coefficient. The differences between the two groups were confirmed by Student t-test. P values <0.05 indicated statistically significant difference. All experiments were repeated 3 times.
Results
Serum of patients with AS and ox-LDL-treated HA-VSMCs showed increased expression of RASSF8-AS1
The lncRNA dataset GSE146882 consisting of patients with AS and sex- and age-matched normal participants was downloaded from the GEO database for analysis. It was found that serum RASSF8-AS1 of patients with AS was significantly increased compared to healthy participants (Figure 1A). ROC analysis indicated that RASSF8-AS1 expression predicted the presence of AS (AUC =0.77; P value =0.04; 95% CI =0.55–0.99; Figure 1B). Peripheral blood samples from patients with AS (n=20) showed increased level of RASSF8-AS1 compared to those of healthy participants (Figure 1C), which was in line with the results from the analysis of the GSE146882 dataset. Recent studies have demonstrated that AS cardiovascular disease (ASCVD) is associated with elevated LDL-C (20,21). Therefore, we analyzed the correlation between serum RASSF8-AS1 expression level and LDL-C content in patients with AS and found that RASSF8-AS1 expression was significantly positively associated with LDL-C levels in the peripheral blood of patients with AS (Figure 1D). ROC curve analysis also demonstrated that both RASSF8-AS1 and LDL-C could distinguish patients with AS, and the specificity of RASSF8-AS1 was higher than that of LDL-C (RASSF8-AS1: AUC =0.95; P value <0.001, 95% CI =0.90–1.01; LDL-C: AUC =0.72, P value =0.01, 95% CI =0.58–0.88; Figure 1E). Finally, RASSF8-AS1 in HA-VSMCS treated by ox-LDL (0, 25, 50, 75, and 100 µg/mL) was detected by qRT-PCR. RASSF8-AS1 showed an increased expression in HA-VSMCs treated by ox-LDL in a concentration-dependent manner (Figure 1F). As RASSF8-AS1 was upregulated in the peripheral blood of patients with AS and VSMCs treated by ox-LDL, it may serve as a diagnostic marker for AS.
RASSF8-AS1 knockdown inhibited cell proliferation and promoted apoptotic effects in ox-LDL-treated HA-VSMCs
To confirm the role of RASSF8-AS1 in ox-LDL-treated HA-VSMCs, shRNA targeting RASSF8-AS1 was designed to knockdown its expression in HA-VSMCs. sh-RASSF8-AS1#1 and sh-RASSF8-AS1#2 evidently downregulated RASSF8-AS1 expression in HA-VSMCs, especially sh-RASSF8-AS1#1 (Figure 2A). Hence, sh-RASSF8-AS1#1 (sh-RASSF8-AS1) was used to knock down the expression of RASSF8-AS1. Furthermore, ox-LDL increased cell viability in HA-VSMCs, while RASSF8-AS knockdown inhibited the ox-LDL-induced viability of HA-VSMCs (Figure 2B,2C). However, ox-LDL promoted the protein expression of proliferating cell nuclear antigen (PCNA) and Kiel 67 antigen (Ki-67) in HA-VSMCs, and RASSF8-AS1 knockdown reduced the expression of PCNA and Ki-67 (Figure 2D,2E). ox-LDL inhibited the apoptosis of HA-VSMCs, which was inversely increased by RASSF8-AS1 knockdown (Figure 2F,2G). Overall, RASSF8-AS1 deficiency inhibited the proliferative and antiapoptotic activity of HA-VSMCs treated by ox-LDL.
RASSF8-AS1 sponged miR-188-3p to downregulate miR-188-3p in HA-VSMCs treated by ox-LDL
For determining the molecular mechanism of RASSF8-AS1, RNA nucleocytoplasmic separation combined with qRT-PCR was carried out to analyze the localization of RASSF8-AS1 in HA-VSMCs. The results showed that a small amount of RASSF8-AS1 was detected in the nucleus, and RASSF8-AS1 was mainly localized in the cytoplasm (Figure 3A). DIANA-LncBase Predicted v.2 was further used predicted the miRNAs targeted to RASSF8-AS1. It was found that miR-188-3p and RASSF8-AS1 had targeted binding sites. Patients with AS and ox-LDL-treated HA-VSMCs exhibited decreased expression of miR-188-3p (Figure S1A and Figure 3B). miR-188-3p levels showed the potential of predicting the risk for AS (AUC =0.78; Figure S1B). Moreover, our data revealed a negative correlation between serum miR-188-3p and RASSF8-AS1 in patients with AS (R=–0.75; P<0.001; Figure 3C). To prove miR-188-3p was targeted by RASSF8-AS1, a mutant type of RASSF8-AS1 was produced (Figure 3D). Dual-luciferase reporter assay demonstrated that RASSF8-AS1 resulted in targeted inhibition of miR-188-3p transcription (Figure 3E), which was further confirmed in HA-VSMCs with high or low expression of RASSF8-AS1 (Figure 3F). The ox-LDL induced the down-regulation of miR-188-3p in HA-VSMCs, the effect was significantly reversed by downregulation of RASSF8-AS1 (Figure 3G). The results demonstrated that RASSF8-AS1 inhibited miR-188-3p expression in HA-VSMCs by sponging miR-188-3p in response to ox-LDL.
RASSF8-AS1 knockdown inhibited the cell proliferation and apoptosis in ox-LDL-treated HA-VSMCs by up-regulating miR-188-3p
To determine whether RASSF8-AS1 affects the biological function of HA-VSMCs by regulating miR-188-3p in response to ox-LDL, HA-VSMCs were next incubated with ox-LDL after transfection of shRASSF8-AS1 alone or with miR-188-3p inhibitor. RASSF8-AS1 knockdown increased miR-188-3p expression, which was significantly inhibited by miR-188-3p inhibitor (Figure 4A). RASSF8-AS1 knockdown apparently decreased cell viability of HA-VSMCs after ox-LDL treatment, which could be weakened by silencing miR-188-3p (Figure 4B). Moreover, RASSF8-AS1 knockdown reduced PCNA and Ki-67 expression in HA-VSMCs treated by ox-LDL, which could be retarded by silencing miR-188-3p (Figure 4C and Figure S2). RASSF8-AS1 knockdown significantly elevated cell apoptosis of HA-VSMCs in response to ox-LDL, but silencing miR-188-3p abrogated these effects (Figure 4D). Together, the above data suggested that knockdown of RASSF8-AS1 suppressed proliferation and promoted apoptosis via upregulating miR-188-3p in HA-VSMCs treated by ox-LDL.
ATG7 was targeted by miR-188-3p in HA-VSMCs in response to ox-LDL
The targeted genes of miR-188-3p were predicted using miRWalk database. The results revealed 2 binding sites to miR-188-3p at the 3'-UTR of ATG7. This finding indicated that ATG7 was a downstream targeted gene of miR-188-3p. Furthermore, ox-LDL induced the mRNA and protein expression of ATG7 in HA-VSMCs (Figure 5A). High expression of ATG7 mRNA was confirmed in patients with AS (Figure 5B). miR-188-3p overexpression decreased the transcript level of ATG7, while miR-188-3p knockdown intensified the transcription of ATG7 (Figure S3 and Figure 5C). This result indicated that ATG7 expression was negatively modulated by miR-188-3p. Luciferase reporter assay confirmed the targeting relationship between ATG7 and miR-188-3p in both the WT and MUT of ATG7 (Figure 5D). miR-188-3p overexpression inhibited the relative luciferase activities of ATG7-WT (4,691–4,712 nt) in HA-VSMCs, but conferred no significant effects on the relative luciferase activities of ATG7-MUT (4,691–4,712 nt), ATG7-WT (4,651–4,670 nt), or ATG7-MUT (4,651–4,670 nt; Figure 5E), suggesting miR-188-3p directly binds to ATG7-3UTR (4,691–4,712 nt) to regulate ATG7 transcriptional activity. miR-188-3p overexpression inhibited ATG7 expression in HA-VSMCs in response to ox-LDL (Figure 5F and Figure S4). Hence, ATG7 is a downstream targeted gene of miR-188-3p, and its expression was mediated by miR-188-3p in HA-VSMCs after ox-LDL treatment.
RASSF8-AS1 elevated ATG7 expression and autophagy through sponging miR-188-3p in HA-VSMCs treated by ox-LDL
ATG7 is an autophagy-related gene, and so we hypothesized that RASSF8-AS1 regulates ATG7 and thus autophagy via miR-188-3p. To confirm the above hypothesis, Western blot was performed to ascertain the protein expression of ATG7 and autophagy markers (LC3 I, LC3 II, Beclin-1, and p62). In HA-VSMCs after ox-LDL treatment, RASSF8-AS1 knockdown markedly decreased ATG7 protein expression, reduced LC3 II and Beclin-1 expression, decreased the ratio of LC3 II to LC3 I, and increased P62 expression. However, these effects were reversely abrogated by silencing miR-188-3p (Figure 6A-6F). The above results suggest that knockdown of RASSF8-AS1 suppresses ATG7 expression and autophagy by upregulation of miR-188-3p in HA-VSMCs after ox-LDL treatment.
RASSF8-AS1 knockdown restrained the cell proliferative and anti-apoptosis via downregulation of ATG7 in ox-LDL-treated HA-VSMCs
Previous studies have shown that ATG7 mediates autophagy to affect biological function of VSMCs (22-26). Therefore, we speculated that RASSF8-AS1 affected the biological function of HA-VSMCs in AS by regulating ATG7 expression. As shown in Western blot (Figure 7A), by, knockdown of RASSF8-AS1 in ox-LDL-treated HA-VSMCs significantly decreased the protein expression of ATG7 and Beclin-1, repressed the ratio of LC3 II and LC3 I, as well as increased the expression protein of P62, and these effects were abrogated by overexpression of ATG7 (Figure 7A-7E), suggesting that RASSF8-AS1 knockdown promoted autophagy of HA-VSMCs induced by ox-LDL by regulating ATG7. Subsequently, to determine whether RASSF8-AS1 affected the biological function of HA-VSMCs by regulating ATG7 in response to ox-LDL, HA-VSMCs were treated with ox-LDL after transfection of shRASSF8-AS1 alone or with ATG7. RASSF8-AS1 knockdown decreased cell viability of HA-VSMCs treated by ox-LDL, which was relieved by ATG overexpression (Figure 7F). Meanwhile, RASSF8-AS1 knockdown decreased PCNA and Ki-67 expression in ox-LDL-treated HA-VSMCs, while this inhibitory effect was reserved by ATG7 upregulation (Figure 7G). Moreover, results from flow cytometry indicated that RASSF8-AS1 knockdown caused apoptosis of HA-VSMCs treated by ox-LDL, and this change was significantly relieved by ATG7 overexpression (Figure 7H,7I). The above results indicate that knockdown of RASSF8-AS1 inhibits the proliferation and anti-apoptosis via the regulation of ATG7-mediated autophagy in HA-VSMCs treated by ox-LDL.
Discussion
Autophagy is involved in the cellular stress response and phenotypic switching of VSMCs (27). It has been speculated that autophagy protects VSMCs against atherogenic stressors and massive stimuli and stressors such as lipid species and reactive oxygen, which is an adaptive mechanism found so far (27). Atherogenic oxidized lipids like ox-LDL increase autophagy-related protein expression and autophagosome accumulation in VSMCs, inducing a strong activation of autophagy (28). Whether autophagy is a protective or deleterious mechanism in vascular pathology is still controversial. However, there is a general consensus that VSMC survival is promoted by successful autophagy under conditions associated with extreme lipid peroxidation. Overactivated autophagy can induce the autophagic death of VSMCs, leading to reduced collagen synthesis and thus plaque instability (29). Here, we provide evidence that RASSF8-AS1 modulates autophagy by targeting miR-188-3p, an mRNA-binding miRNA that increases the expression of ATG7.
Genomewide transcription profiling of AS and other cardiovascular diseases has provided new insights into the molecular mechanisms involving lncRNAs (30-32). The aberrantly expressed lncRNAs regulate the ubiquitinated proteasome pathways in AS-induced ischemic stroke (31), affect gene expression relevant to inflammation in coronary artery disease (30), and mediate T cell receptor signaling pathway in carotid AS (32). Altered lncRNA transcriptomic profiles suggest that RASSF8-AS1 is increased in patients with AS. Consistent with this finding, we detected an increase in RASSF8-AS1 expression in 20 enrolled patients with AS. It has been well-established that high serum concentrations of LDL-C are fundamental in the initiation and development of AS (33). Our study observed that increased expression of RASSF8-AS1 was associated with a high concentration of LDL-C in patients with AS. RASSF8-AS1 expression in ox-LDL-treated HA-VSMCs was directly proportional to the ox-LDL concentration. ROC analysis suggested that the level of ox-LDL in peripheral blood of patients with AS was positively correlated with the expression of RASSF8-AS1. These findings identify RASSF8-AS1 as a potent indicator and a risk factor for AS.
ox-LDL exerts mitogenic effects on VSMCs via the activation of Ras/Raf/MEK/MAPK pathway (34). A previous study has provided evidence that mildly oxidized LDL functions synergistically with angiotensin II in inducing the DNA synthesis of VSMCs (35). This study found that RASSF8-AS1 silencing inhibited cell viability and induced apoptosis with decreased PCNA and Ki-67 expression in response to ox-LDL stimulation. It has been reported that symptomatic patients with carotid obstructive plaques are commonly detected with PCNA protein, showing a progressive alteration of the cellular homeostasis and unstable plaque (36). Ki-67 has been shown to be useful for the identification of replicative SMCs functioning in the development of intimal thickening during AS or after arterial lesion (37). VSMCs are considered to be the primary source of the extracellular matrix in diffuse intimal thickenings, which likely causes the enhancement of thickness of the intima, accounting for the progression of AS (38). These findings suggest that RASSF8-AS1 serves as a positive feedback regulator when HA-VSMCs are stimulated by ox-LDL, which may cause the development and progression of AS plaque.
Direct binding of lncRNA and miRNA appears to alter the cellular function of downstream molecules, leading to abnormalities of vascular endothelial cells and SMCs (39-42). miR-188-3p was predicted to be targeted by RASSF8-AS1 based on bioinformatic analysis. However, the interaction of RASSF8-AS1 and miR-188-3p has not been experimentally validated. In this study, we confirmed miR-188-3p as a target of RASSF8-AS1. Patients with AS showed decreased expression of miR-188-3p, which is consistent with the results from apolipoprotein E (ApoE) knockout mice (43,44). There is evidence that miR-188-3p, which targets fibroblast growth factor 1 and decreases its expression, inhibits the proliferation and migration of VSMCs (43). Additionally, Zhang et al. characterized miR-188-3p as a regulator alleviating macrophage inflammatory response and reducing intravascular lipid accumulation in ApoE-deficient mice (44). Here, we identified RASSF8-AS1 sponging miR-188-3p and RASSF8-AS1 silencing enhanced miR-188-3p expression in ox-LDL-treated HA-VSMCs. Hence, we assumed RASSF8-AS1 exerts its AS effect by targeting miR-188-3p. Our experimental results suggested that miR-188-3p downregulation induced by RASSF8-AS1 increased cell viability, decreased apoptosis, and increased PCNA and Ki-67 expression in HA-VSMCs treated by ox-LDL.
Autophagy is tightly governed by highly conserved autophagy-related genes and mediated by lysosome in the turnover of damaged cytosolic materials. VSMCs from AS plaques were observed under transmission electron microscopy to have characteristics of autophagy (45,46). Autophagy is considered a crucial determinant in the cellular simulative response and phenotypic switching of VSMCs following vascular injury (29). ATG7 is an essential gene for the ATG conjugation systems involved in amino acid supply and autophagosome formation. In vascular disease, prolonged stress conditions such as hypoxia/ischemia or oxidative stress dysregulate autophagy homeostasis and may activate autophagic cell death (47). Here, ATG7 expression was increased in patients with AS compared with healthy participants. ox-LDL induced autophagy and increased the expression of ATG7. Most interestingly, RASSF8-AS1 enhanced ATG7 expression and autophagy in ox-LDL-treated HA-VSMCs by sponging miR-188-3p. Consequently, we emphasize the possibility that RASSF8-AS1 regulates cell proliferation and apoptosis by regulating ATG7-mediated autophagy pathway.
Conclusions
Our data revealed that the upregulation of RASSF8-AS1 in AS can be used as a diagnostic marker for AS and that RASSF8-AS1 knockdown inhibited proliferation, promoted apoptosis, and suppressed autophagy in HA-VSMCs treated by ox-LDL. Notably, mechanistic analysis confirmed that a newly discovered RASSF8-AS1/miR-188-3p/ATG7-mediated autophagy pathway regulated the biological function of VSMCs in AS, and intervention of this pathway could be incorporated into diagnostic tools and novel therapeutic strategies in AS.
Acknowledgments
Funding: This study was supported by the National Natural Science Foundation of China (No. 82074139).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-6457/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-6457/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-6457/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All participants who participated in this study signed an informed consent form, and this study was approved by the Ethics Committee of the First Affiliated Hospital of Guangdong Pharmaceutical University (No. 202112). The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Libby P, Buring JE, Badimon L, et al. Atherosclerosis. Nat Rev Dis Primers 2019;5:56. [Crossref] [PubMed]
- Libby P. The changing landscape of atherosclerosis. Nature 2021;592:524-33. [Crossref] [PubMed]
- Rafieian-Kopaei M, Setorki M, Doudi M, et al. Atherosclerosis: process, indicators, risk factors and new hopes. Int J Prev Med 2014;5:927-46. [PubMed]
- Libby P, Bornfeldt KE, Tall AR. Atherosclerosis: Successes, Surprises, and Future Challenges. Circ Res 2016;118:531-4. [Crossref] [PubMed]
- Dubland JA, Francis GA. So Much Cholesterol: the unrecognized importance of smooth muscle cells in atherosclerotic foam cell formation. Curr Opin Lipidol 2016;27:155-61. [Crossref] [PubMed]
- Owens GK, Kumar MS, Wamhoff BR. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol Rev 2004;84:767-801. [Crossref] [PubMed]
- Mulvihill ER, Jaeger J, Sengupta R, et al. Atherosclerotic plaque smooth muscle cells have a distinct phenotype. Arterioscler Thromb Vasc Biol 2004;24:1283-9. [Crossref] [PubMed]
- Ballantyne MD, McDonald RA, Baker AH. lncRNA/MicroRNA interactions in the vasculature. Clin Pharmacol Ther 2016;99:494-501. [Crossref] [PubMed]
- Mas AM, Huarte M. lncRNA-DNA hybrids regulate distant genes. EMBO Rep 2020;21:e50107. [Crossref] [PubMed]
- Jonas K, Calin GA, Pichler M. RNA-Binding Proteins as Important Regulators of Long Non-Coding RNAs in Cancer. Int J Mol Sci 2020;21:2969. [Crossref] [PubMed]
- Ferrè F, Colantoni A, Helmer-Citterich M. Revealing protein-lncRNA interaction. Brief Bioinform 2016;17:106-16. [Crossref] [PubMed]
- Simion V, Zhou H, Haemmig S, et al. A macrophage-specific lncRNA regulates apoptosis and atherosclerosis by tethering HuR in the nucleus. Nat Commun 2020;11:6135. [Crossref] [PubMed]
- Simion V, Zhou H, Pierce JB, et al. LncRNA VINAS regulates atherosclerosis by modulating NF-κB and MAPK signaling. JCI Insight 2020;5:e140627. [Crossref] [PubMed]
- Lin D, Zhang X, Zhang C, et al. LncRNA-TCONS_00034812 is upregulated in atherosclerosis and upregulates miR-21 through methylation in vascular smooth muscle cells. Ann Transl Med 2021;9:1005. [Crossref] [PubMed]
- Tao J, Hu Y. Diagnostic and prognostic significance of lncRNA SOX2-OT in patients with carotid atherosclerosis. BMC Cardiovasc Disord 2022;22:211. [Crossref] [PubMed]
- Guo FX, Wu Q, Li P, et al. The role of the LncRNA-FA2H-2-MLKL pathway in atherosclerosis by regulation of autophagy flux and inflammation through mTOR-dependent signaling. Cell Death Differ 2019;26:1670-87. [Crossref] [PubMed]
- Wang Y, Yang Y, Zhang T, et al. LncRNA SNHG16 accelerates atherosclerosis and promotes ox-LDL-induced VSMC growth via the miRNA-22-3p/HMGB2 axis. Eur J Pharmacol 2022;915:174601. [Crossref] [PubMed]
- Wu Y, Zhang F, Lu R, et al. Functional lncRNA-miRNA-mRNA networks in rabbit carotid atherosclerosis. Aging (Albany NY) 2020;12:2798-813. [Crossref] [PubMed]
- He L, Chen Y, Hao S, et al. Uncovering novel landscape of cardiovascular diseases and therapeutic targets for cardioprotection via long noncoding RNA-miRNA-mRNA axes. Epigenomics 2018;10:661-71. [Crossref] [PubMed]
- Peng J, Luo F, Ruan G, et al. Hypertriglyceridemia and atherosclerosis. Lipids Health Dis 2017;16:233. [Crossref] [PubMed]
- Pinkosky SL, Newton RS, Day EA, et al. Liver-specific ATP-citrate lyase inhibition by bempedoic acid decreases LDL-C and attenuates atherosclerosis. Nat Commun 2016;7:13457. [Crossref] [PubMed]
- Grootaert MO, da Costa Martins PA, Bitsch N, et al. Defective autophagy in vascular smooth muscle cells accelerates senescence and promotes neointima formation and atherogenesis. Autophagy 2015;11:2014-32. [Crossref] [PubMed]
- He HQ, Qu YQ, Kwan Law BY, et al. AGEs-Induced Calcification and Apoptosis in Human Vascular Smooth Muscle Cells Is Reversed by Inhibition of Autophagy. Front Pharmacol 2021;12:692431. [Crossref] [PubMed]
- De Munck DG, Leloup AJA, De Meyer GRY, et al. Defective autophagy in vascular smooth muscle cells increases passive stiffness of the mouse aortic vessel wall. Pflugers Arch 2020;472:1031-40. [Crossref] [PubMed]
- Mochida A, Mita T, Azuma K, et al. Defective autophagy in vascular smooth muscle cells enhances the healing of abdominal aortic aneurysm. Physiol Rep 2021;9:e15000. [Crossref] [PubMed]
- De Munck DG, De Moudt S, Roth L, et al. Defective Autophagy in Vascular Smooth Muscle Cells Alters Vascular Reactivity of the Mouse Femoral Artery. Front Physiol 2020;11:548943. [Crossref] [PubMed]
- Tai S, Hu XQ, Peng DQ, et al. The roles of autophagy in vascular smooth muscle cells. Int J Cardiol 2016;211:1-6. [Crossref] [PubMed]
- Salabei JK, Hill BG. Implications of autophagy for vascular smooth muscle cell function and plasticity. Free Radic Biol Med 2013;65:693-703. [Crossref] [PubMed]
- Grootaert MOJ, Moulis M, Roth L, et al. Vascular smooth muscle cell death, autophagy and senescence in atherosclerosis. Cardiovasc Res 2018;114:622-34. [Crossref] [PubMed]
- Li L, Wang L, Li H, et al. Characterization of LncRNA expression profile and identification of novel LncRNA biomarkers to diagnose coronary artery disease. Atherosclerosis 2018;275:359-67. [Crossref] [PubMed]
- Ruan W, Wu J, Su J, et al. Altered lncRNAs Transcriptomic Profiles in Atherosclerosis-Induced Ischemic Stroke. Cell Mol Neurobiol 2022;42:265-78. [Crossref] [PubMed]
- Wu Y, Zhang F, Li X, et al. Systematic analysis of lncRNA expression profiles and atherosclerosis-associated lncRNA-mRNA network revealing functional lncRNAs in carotid atherosclerotic rabbit models. Funct Integr Genomics 2020;20:103-15. [Crossref] [PubMed]
- Mortensen MB, Nordestgaard BG. Elevated LDL cholesterol and increased risk of myocardial infarction and atherosclerotic cardiovascular disease in individuals aged 70-100 years: a contemporary primary prevention cohort. Lancet 2020;396:1644-52. [Crossref] [PubMed]
- Yang CM, Chien CS, Hsiao LD, et al. Mitogenic effect of oxidized low-density lipoprotein on vascular smooth muscle cells mediated by activation of Ras/Raf/MEK/MAPK pathway. Br J Pharmacol 2001;132:1531-41. [Crossref] [PubMed]
- Watanabe T, Pakala R, Katagiri T, et al. Mildly oxidized low-density lipoprotein acts synergistically with angiotensin II in inducing vascular smooth muscle cell proliferation. J Hypertens 2001;19:1065-73. [Crossref] [PubMed]
- Lavezzi AM, Milei J, Grana DR, et al. Expression of c-fos, p53 and PCNA in the unstable atherosclerotic carotid plaque. Int J Cardiol 2003;92:59-63. [Crossref] [PubMed]
- Aoyagi M, Yamamoto M, Wakimoto H, et al. Immunohistochemical detection of Ki-67 in replicative smooth muscle cells of rabbit carotid arteries after balloon denudation. Stroke 1995;26:2328-31; discussion 2331-2. [Crossref] [PubMed]
- Bennett MR, Sinha S, Owens GK. Vascular Smooth Muscle Cells in Atherosclerosis. Circ Res 2016;118:692-702. [Crossref] [PubMed]
- Li S, Sun Y, Zhong L, et al. The suppression of ox-LDL-induced inflammatory cytokine release and apoptosis of HCAECs by long non-coding RNA-MALAT1 via regulating microRNA-155/SOCS1 pathway. Nutr Metab Cardiovasc Dis 2018;28:1175-87. [Crossref] [PubMed]
- Wang K, Yang C, Shi J, et al. Ox-LDL-induced lncRNA MALAT1 promotes autophagy in human umbilical vein endothelial cells by sponging miR-216a-5p and regulating Beclin-1 expression. Eur J Pharmacol 2019;858:172338. [Crossref] [PubMed]
- Ann SJ, Bang H, Lee CJ, et al. LncRNA HSPA7 in human atherosclerotic plaques sponges miR-223 and promotes the proinflammatory vascular smooth muscle cell transition. Exp Mol Med 2021;53:1842-9. [Crossref] [PubMed]
- Zhu Y, Yang T, Duan J, et al. MALAT1/miR-15b-5p/MAPK1 mediates endothelial progenitor cells autophagy and affects coronary atherosclerotic heart disease via mTOR signaling pathway. Aging (Albany NY) 2019;11:1089-109. [Crossref] [PubMed]
- Mi S, Wang P, Lin L. miR-188-3p Inhibits Vascular Smooth Muscle Cell Proliferation and Migration by Targeting Fibroblast Growth Factor 1 (FGF1). Med Sci Monit 2020;26:e924394. [Crossref] [PubMed]
- Zhang XF, Yang Y, Yang XY, et al. MiR-188-3p upregulation results in the inhibition of macrophage proinflammatory activities and atherosclerosis in ApoE-deficient mice. Thromb Res 2018;171:55-61. [Crossref] [PubMed]
- Kockx MM, De Meyer GR, Muhring J, et al. Apoptosis and related proteins in different stages of human atherosclerotic plaques. Circulation 1998;97:2307-15. [Crossref] [PubMed]
- Martinet W, De Bie M, Schrijvers DM, et al. 7-ketocholesterol induces protein ubiquitination, myelin figure formation, and light chain 3 processing in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2004;24:2296-301. [Crossref] [PubMed]
- Mameli E, Martello A, Caporali A. Autophagy at the interface of endothelial cell homeostasis and vascular disease. FEBS J 2022;289:2976-91. [Crossref] [PubMed]
(English Language Editor: J. Gray)

