Identification of CaMK4 as a sex-difference-related gene in knee osteoarthritis
Highlight box
Key findings
• CaMK4 is a key sex-related gene influencing the pathogenesis and progression of OA.
What is known and what is new?
• OA is a common degenerative joint disease with a higher prevalence in females than in males.
• The key gene CaMK4 was identified to be involved in the OA progression through bioinformatics analysis of the synovial tissue of male and female patients in the OA datasets. Further in vivo experiments with mice verified that the inhibition of CaMK4 protected articular cartilage after DMM.
What is the implication, and what should change now?
• CaMK4 may be considered as a new target for OA treatment, and its molecular mechanism should be explored in future studies.
Introduction
Osteoarthritis (OA) is a common degenerative joint disease affecting several joints throughout the body, especially those at the knees. The pathology is characterized by synovial inflammation, cartilage destruction, and subchondral osteosclerosis (1), with clinical symptoms of joint pain, swelling, stiffness, and eventually functional impairment (2), which seriously affect the work and life of patients and impose heavy economic burden on individuals and society. Epidemiological surveys show that approximately 18% of women and 9.6% of men aged over 60 years old are affected by OA (3). Women are considered to be at a higher risk of OA onset and progression than men (4). Moreover, a higher prevalence of OA has been reported in women at any age groups than in men, particularly with respect to OA at the knees (5-7), which presents severe clinical symptoms and causes high rates of disabilities (5). The risk of OA in women further increases after menopause (8). However, the exact mechanism by which sex differences contribute to the prevalence of OA remains unknown.
OA occurs as a result of interaction of various tissues in the joint cavity; however, the initiation factor remains unclear (9). Increasing evidence has shown that low-grade chronic inflammation plays a crucial role in the pathogenesis of OA (10). Synovial inflammation exists in all the stages of OA (9,11). In the early stage of OA, the synovial tissue releases inflammatory factors, thereby leading to an imbalance between cartilage repair and degradation. Then, cartilage fragments are produced that react with the synovial tissue and aggravate inflammation, leading to a vicious cycle of local tissue lesions that results in inflammation and repair, thereby aggravating disease progression (12). Therefore, synovial inflammation may be a prerequisite for the development of OA. Thus, the investigation of the sex-difference-related causes of OA synovitis and the exploration of novel therapeutic targets are critical to address the challenges in current clinical treatments.
High-throughput sequencing is a reliable technique for predicting potential therapeutic targets of diseases. Several bioinformatics studies on OA have been conducted (13-16), but there is limited research on the role of sex differences in the development of OA. Therefore, we used bioinformatics analysis combined with the results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) validation of the synovial tissues of patients to investigate the key sex-difference-related genes expressed in the synovial tissues of patients with OA and explore whether these genes can improve the destabilization of the medial meniscus (DMM)-induced articular cartilage damage in a mouse model. We present the following article in accordance with the ARRIVE reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4284/rc).
Methods
Microarray data search and selection
A gene expression chip was obtained from the Gene Expression Omnibus (GEO) public database (https://www.ncbi.nlm.nih.gov/geo), and the OA dataset of the synovial tissue was screened and tested, which yielded three datasets: GSE12021, GSE55457, and GSE36700. The GSE12021 dataset was based on the GPL96 platform (Affymetrix Human Genome U133A Array) and included eight female and two male patients with OA; the GSE55457 dataset was based on the GPL96 platform (Affymetrix Human Genome U133A Array) and included eight female and two male patients with OA; and the GSE36700 dataset was based on the GPL570 platform (Affymetrix Human Genome U133 Plus 2.0 Array) and included four female and one male patient with OA.
Identification of differentially expressed genes (DEGs)
Through the use of the online analysis tool GEO2R (https://www.ncbi.nlm.nih.gov/geo/geo2r/), the three datasets were analyzed to identify DEGs in the synovial tissue of female and male patients with OA. The false detection rate (FDR) adjusted the P values using the Benjamini and Hochberg (BH) Procedure (17) in package. The screening criteria were |log2(FC)| ≥1 and P<0.05 (18). The DEGs screened from the three datasets were intersected with Venn diagrams, and co-expressed DEGs in each dataset were visualized using the “pheatmap” package in R software.
Protein-protein interaction (PPI) network construction and identification of hub genes
String online analysis software was used to predict the known and unknown protein interactions and create a PPI network of DEGs (19). The output results were imported into the Cytoscape (v.3.6.8) software for visualization. The CytoHubba plug-in stress algorithm was used to screen hub genes.
qRT-PCR analysis of hub genes
From May 2021 to February 2022, synovial tissues of eight female and eight male patients with OA at the Tangdu Hospital of the Fourth Military Medical University were collected for verification. To investigate whether the key genes were elevated in patients with OA, synovial tissues were obtained from eight female patients without OA [cases of post-traumatic OA were excluded before collecting the non-OA clinical samples; the eight female patients without OA from whom samples were collected had acute trauma-induced meniscal or ligament injury at the knee but asymptomatic knee joints before injury (preoperative Kellgren-Lawrecne grade ≤1, as determined via X-ray)]. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The research protocol was reviewed and approved by the Ethics Committee of the Tangdu Hospital of the Fourth Military Medical University (No. 202112-01), and informed consent was obtained from all the patients involved. Total RNA was extracted from isolated synovial tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The total RNA was reversely transcribed into cDNA according to the instructions provided in the reverse transcription kit. Real-time PCR was used to determine the relative expression of hub genes in the synovial tissues using the 2−ΔΔCt method with GAPDH as the internal reference. Real-time PCR reactions were performed according to the manufacturer’s protocols. The primer sequences for all genes are shown in Table 1.
Table 1
| Gene | Forward (5'→3') | Reverse (5'→3') |
|---|---|---|
| EGF | GTGCATCCACTTGCACAACC | GCACAAGTGTGACTGGAGGT |
| AQP4 | AGCAGTCACAGCGGAATTTCT | TCTGTTCCACCCCAGTTGATG |
| NTRK3 | CACCCCTTCCTGATGTGGAC | GCCATTGTCCTCACTCGTCA |
| CaMK4 | CCGGATTACTGGATCGACGG | TGTTTGGATGTGAGAGGCG |
| GAPDH | AGAAGGCTGGGGCTCATTTG | AGGGGCCATCCACAGTCTTC |
RT-PCR, reverse transcription polymerase chain reaction.
Establishment and grouping of DMM mouse models
Male wild-type (WT) C57/BL6J mice were provided by the Experimental Animal Center of the Fourth Military Medical University. These mice were housed in standard, individually ventilated cages under specific pathogen-free conditions. Standard laboratory chow and water were provided as food. The procedures and protocols were approved by the Scientific Research Ethics Committee of the Fourth Military Medical University (No. 20220932). All experiments were conducted according to the principles and guidelines of the Care and Use of Laboratory Animals. DMM is the standard surgical approach for treating OA in mice (20). With this approach, healthy C57/BL6J mice were operated on under general anesthesia with 1% sodium pentobarbital. The skin was prepared and sterilized in preparation for aseptic surgery. The medial meniscus medial ligament of the tibia was cut off to establish the DMM model. Mice were divided into three groups according to the experimental purpose: sham operation (n=4), DMM (n=6), and DMM + KN-93 (n=6). In the sham operation group, the treatment was the same as that in the DMM group for except for the cutting of the medial meniscus tibial ligament. Interventions in each group were initiated 4 weeks after the operation. In the DMM + KN-93 group, KN-93 at a dose of 2.67 µg/g was injected intraperitoneally three times a week for 4 weeks (21). The sham operation and DMM groups were administered an equivalent dose of saline. Severe OA developed 8 weeks after surgery (20), following which the mice were euthanized and their knee joints were removed. KN-93, a small molecule inhibitor of CaMK4, was purchased from MedChemExpress (Monmouth Junction, NJ, USA).
Immunohistochemical staining
The paraffin-embedded sections of mice knee joints were dewaxed and hydrated, and the antigens were recovered by boiling the sections with citrate antigen retrieval solution for 15 minutes to block endogenous peroxidase. After blocking the samples with goat serum, rabbit anti-CaMK4 antibody (ZENBIO, Inc., Chengdu, China) was added and the samples were incubated at 4 ℃ overnight. After washing, horseradish peroxidase-labeled goat anti-rabbit IgG (Boster Biological Engineering Co., Ltd., Wuhan, China) was added and the samples were incubated at room temperature for 1 hour. Next, DAB chromogen and hematoxylin were used for counterstaining (Boster Biological Engineering), followed by dehydration and transparent, neutral resin sealing, and the samples were examined using light microscopy.
Histological analysis of joint damage
Sections were obtained from the sagittal position of the medial tibial plateau of the mouse, and Hematoxylin and eosin (HE) staining and Safranin O-fast green dye (Serviobio) staining were performed according to the instructions from the manufacturer. Synovial inflammation was scored according to the relevant literature (22). The degree of cartilage damage was assessed based on the modified Mankin score (23). A higher modified Mankin score indicates more severe cartilage damage.
Statistical analysis
GraphPad 9.0 software was used for statistical analysis, and data were presented as means ± SD. Data were analyzed and compared among the three groups using an independent samples t-test. In addition, Mann-Whitney U test was used for analyzing data on synovial inflammation scores and immunohistochemical staining. The score-related data were analyzed using Kruskal-Wallis test, and a P value of <0.05 was considered statistically significant.
Results
Sex-related differential gene expression analysis of patients with OA
DEGs of male and female patients with OA in the three datasets were analyzed according to the criteria of |log2(FC)| ≥1 and P<0.05. In the GSE12021 dataset, 611 DEGs were screened, including 491 upregulated and 120 downregulated genes. In the GSE55457 dataset, 610 DEGs were screened, including 490 upregulated and 120 downregulated genes. In the GSE36700 dataset, 3,551 DEGs were screened, including 2,261 upregulated and 1,290 downregulated genes. The intersection of the three differential gene expression profiles yielded 99 DEGs, of which 77 were upregulated and 22 were downregulated in all three datasets (Figure 1A, Table S1). Furthermore, heatmaps were drawn for co-up/downregulated DEGs in each dataset (Figure 1B).
PPI network construction and hub genes
Using the String online analysis database and Cytoscape software, a PPI interaction network with 140 nodes and 1730 edges was constructed (Figure 2A). Using the CytoHubba plug-in stress algorithm, EGF, AQP4, CDC42, NTRK3, ERBB2, STAT1, and CaMK4 were identified as hub genes that lead to sex-related differences in OA (Figure 2B).
qRT-PCR validation of hub genes
EGF, AQP4, CDC42, ERBB2, and STAT1 have been reported to regulate OA (18,24-26), but no such finding has been reported for NTRK3 and CaMK4. We herein selected EGF, AQP4, NTRK3, and CaMK4 for verification. qRT-PCR revealed that the relative expression levels of EGF, AQP4, and CaMK4 were significantly higher in the female OA group than that in the male OA group; this finding was consistent with the results of microarray data. However, no significant difference in the expression level of NTRK3 was observed (Figure 3A). It has been reported that the prevalence of OA is higher in women than in men, and the pain and disability associated with OA are more common in women than in men (5). Furthermore, CaMK4 was screened out among the hub genes as the key sex-related gene of OA. To explore whether CaMK4 is elevated only in patients with OA, we used the synovial tissue of female patients without OA to re-verify the results. It was observed that compared with female patients without OA, the expression of CaMK4 was significantly increased in the synovial tissue of female patients with OA (Figure 3B). Hence, CaMK4 may not only be a key sex-related gene during OA progression but also a crucial gene involved in OA pathogenesis.
Increased inflammation and increased expression of CaMK4 at the knee joints of mice after DMM
HE staining showed that inflammatory cells infiltrated the synovial tissue of the knee joints of mice after DMM, with apparent vascular proliferation and aggravated inflammation (Figure 4A). Immunohistochemical staining showed that the expression of CaMK4 in the synovial tissue of the knee joints of mice after DMM increased, mainly in the extracellular matrix of synovial cells, but decreased when the CaMK4 inhibitor KN-93 was administered; the difference was statistically significant (Figure 4B).
Inhibition of CaMK4 expression protects the articular cartilage in DMM mice model
Mice in the DMM group showed severe cartilage damage, osteophyte formation, and cartilage damage compared with those in the sham-operation group, as observed through HE staining and safranin-fast green staining. The layer thickness decreased, indicating successful modeling. However, by inhibiting the expression of CaMK4, the abovementioned pathological changes improved. The modified Mankin score in the DMM + KN-93 group was lower than that in the DMM group. Other pathological findings, such as hyperostosis size (grade 0–3) and osteophyte maturity (grade 0–3) showed similar trends with the modified Mankin score (Figure 5). These results showed that the inhibition of CaMK4 expression alleviates cartilage damage.
Discussion
OA is a common degenerative joint disease among the elderly and shows different incidence rates in men and women, with a higher incidence rate in women than in men (8). Synovial inflammation, which occurs throughout OA development, is one of its essential pathological manifestations, which can damage adjacent bones and cartilage, forming a vicious circle (27,28). However, no effective treatment is currently available for OA. Also, the role of sex differences in OA pathogenesis remains unclear. Therefore, exploring the molecular mechanism underlying sex differences in OA occurrence and the role of synovial inflammation in OA would be of great significance for improving the prognosis of patients with OA. Bioinformatics methods were used to analyze and verify the mRNA expression profiles of the synovial tissues of male and female patients with OA, identify key genes, and further explore the role of key genes in OA treatment.
In the present study, the eligible datasets were selected through a database search, but the sample size of male patients with OA in each dataset was small, justifying the higher prevalence of OA in women than in men in clinical practice (5). Therefore, GSE55457, GSE12021, and GSE36700, which were applied more frequently than other datasets in previous studies, were selected for analysis. The gene expression profiles of the synovial tissues from male and female patients with OA patients were analyzed separately in the three datasets and then 99 overlapping DEGs, including 77 upregulated and 22 downregulated genes, were identified by intersecting the three datasets. A PPI network of DEGs was constructed and the following seven hub genes were screened: EGF, AQP4, CDC42, NTRK3, ERBB2, STAT1, and CaMK4. In addition, some hub genes were verified via qRT-PCR. The results of EGF, AQP4, and CaMK4 expression and bioinformatics were consistent with the analysis. EGF, AQP4, and CaMK4 were highly expressed in the synovial tissues of female patients with OA compared with the synovial tissues of male patients with OA. Epidermal growth factor (EGF) is an active polypeptide consisting of 53 amino acids that stimulate epidermal and other cell divisions (29). Zhang et al. (30) used Mig6-knockout mice, which showed increased EGFR activity and observed significant joint swelling and deformity, indicating that EGFR signaling regulates chondrocyte proliferation, survival, and differentiation. Aquaporins (AQPs) are members of the membrane transporter family and are expressed in various cells and tissues (31). AQPs regulate the inflow and outflow of water and small molecules (32). This study confirmed that AQP4 was highly expressed in the synovial tissues of female patients with OA, which was consistent with the findings of Cai et al. (24).
Here, CaMK4, which has not been reported in OA, was selected as the key gene. CaMK4 is a multifunctional serine/threonine kinase and an important member of the calmodulin-dependent kinase family (33). CaMK4 plays an important role in calcium regulation in the central nervous system. CaMK4 is mainly distributed in the brain, thymus, bone marrow, and other tissues (34) and is also expressed in the cytoplasm and nucleus of normal human peripheral blood T lymphocytes (35). CaMK4 controls the activity of the IL-2 promoter by regulating the activity of AP-1, and IL-2 is essential for the proliferation and activation of naive T cells and the differentiation of regulatory T lymphocytes. Koga extracted T lymphocytes from the spleen of lupus mice and found that the expression of nuclear CaMK4 was significantly increased and the secretion of IL-2 was decreased, while CaMK4 knockout increased the expression of IL-2 and the number of activated regulatory T cells, indicating that CaMK4 is involved in the immune response of T cells (36). CaMK4 promotes the transcription of inflammatory cytokines and aberrant proliferation or migration of various immune cells (36) by recruiting IL-1 and IL-6 and producing the monocyte chemotactic proteins (i.e., MCP-1 and MCP-3) of macrophages, thereby increasing the inflammatory response of the muscle in the acute phase (21).
Furthermore, CaMK4 is involved in the pathophysiological mechanisms of multiple inflammatory diseases (37). Low-grade chronic inflammation is central to OA development (10). Immune cell infiltration of the synovial tissue is associated with disease progression (38), in which T cells are associated with OA close relationship among them. CaMK4 is highly expressed in CD4+ T cells, and the accumulation of CD4 T cells is a common phenomenon in the process of local inflammation in RA and OA joints and is involved in OA progression (39), but its relationship with OA is unclear. In the present study, screening and quantitative polymerase chain reaction (qPCR) verification revealed that CaMK4 was highly expressed in patients with OA. The severity and location of postoperative cartilage lesions in the DMM mouse model are similar to those in humans with OA and are sufficiently sensitive to be used as a preferred model for studying OA (40). Immunohistochemical analysis, HE staining, and safranin O staining demonstrated that the knee joint of the mice was smooth after modeling. However, membrane inflammation was increased, CaMK4 expression was elevated, and cartilage damage was severe. Since synovial inflammation appears in the early phase of OA (10) and accompanies the disease throughout, selection of key genes in the synovial tissue of male and female patients is important for the early treatment of OA. The time point for studying OA disease progression in the DMM model is optional, with moderate or severe cartilage damage appearing at 8 weeks post DMM (40), a better time point through which to observe the effects of intervention (41,42). Intraperitoneal injection of the CaMK4 inhibitor KN-93 reversed the abovementioned pathological symptoms, indicating that inhibition of CaMK4 can protect the articular cartilage. However, OA disease is progressive, and the present study comes with limitations as it assessed only a single time point. In the future, selecting multiple time points to determine the role of pivotal genes in the regulation of OA would be worthwhile.
KN-93 is a CaMK4 inhibitor (43-45), but KN-93 also inhibits CaMKII. Liang et al. reported that cyclic mechanical stress promotes chondrocyte proliferation and matrix synthesis via the integrin β1-CaMKII-Pyk2-ERK1/2 signaling cascade, but inhibition of CaMKII prevents cyclic mechanical stress-induced chondrocyte proliferation and matrix synthesis (46). In the present study, bioinformatics screening combined with validation revealed that only CaMK4 was highly expressed in patients with OA, and immunohistochemical staining showed increased CaMK4 expression in the mouse knee synovial tissues after DMM. However, when treated with KN-93, the expression of CaMK4 in the synovial tissues of mice knees significantly decreased. Therefore, we speculated that this effect was mediated by the inhibition of CaMK4 expression by KN-93.
Conclusions
In conclusion, the key gene CaMK4 was identified to be involved in the OA progression through bioinformatics analysis of the synovial tissue of male and female patients in the OA datasets. Further in vivo experiments with mice verified that the inhibition of CaMK4 protected articular cartilage after DMM, and its molecular mechanism should be explored in future studies.
Acknowledgments
Funding: This work was supported by funding from the Natural Science Foundation of Shaanxi (No. 2020SF-094).
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4284/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4284/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4284/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The research protocol was reviewed and approved by the ethics committee of the Tangdu Hospital of the Fourth Military Medical University (No. 202112-01), and informed consent was taken from all the patients. The procedures and protocols for animal experiments were approved by the Scientific Research Ethics Committee of the Fourth Military Medical University (No. 20220932). All animal experiments were conducted following the principles and guidelines of the Care and Use of Laboratory Animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Aspden RM, Saunders FR. Osteoarthritis as an organ disease: from the cradle to the grave. Eur Cell Mater 2019;37:74-87. [Crossref] [PubMed]
- Mathiessen A, Conaghan PG. Synovitis in osteoarthritis: current understanding with therapeutic implications. Arthritis Res Ther 2017;19:18. [Crossref] [PubMed]
- Lourido L, Calamia V, Fernández-Puente P, et al. Secretome analysis of human articular chondrocytes unravels catabolic effects of nicotine on the joint. Proteomics Clin Appl 2016;10:671-80. [Crossref] [PubMed]
- Bierma-Zeinstra SM, Koes BW. Risk factors and prognostic factors of hip and knee osteoarthritis. Nat Clin Pract Rheumatol 2007;3:78-85. [Crossref] [PubMed]
- Srikanth VK, Fryer JL, Zhai G, et al. A meta-analysis of sex differences prevalence, incidence and severity of osteoarthritis. Osteoarthritis Cartilage 2005;13:769-81. [Crossref] [PubMed]
- Blagojevic M, Jinks C, Jeffery A, et al. Risk factors for onset of osteoarthritis of the knee in older adults: a systematic review and meta-analysis. Osteoarthritis Cartilage 2010;18:24-33. [Crossref] [PubMed]
- Safiri S, Kolahi AA, Smith E, et al. Global, regional and national burden of osteoarthritis 1990-2017: a systematic analysis of the Global Burden of Disease Study 2017. Ann Rheum Dis 2020;79:819-28. [Crossref] [PubMed]
- Phinyomark A, Osis ST, Hettinga BA, et al. Gender differences in gait kinematics for patients with knee osteoarthritis. BMC Musculoskelet Disord 2016;17:157. [Crossref] [PubMed]
- de Lange-Brokaar BJ, Ioan-Facsinay A, van Osch GJ, et al. Synovial inflammation, immune cells and their cytokines in osteoarthritis: a review. Osteoarthritis Cartilage 2012;20:1484-99. [Crossref] [PubMed]
- Wang X, Hunter D, Xu J, et al. Metabolic triggered inflammation in osteoarthritis. Osteoarthritis Cartilage 2015;23:22-30. [Crossref] [PubMed]
- Loeuille D, Chary-Valckenaere I, Champigneulle J, et al. Macroscopic and microscopic features of synovial membrane inflammation in the osteoarthritic knee: correlating magnetic resonance imaging findings with disease severity. Arthritis Rheum 2005;52:3492-501. [Crossref] [PubMed]
- Sanchez-Lopez E, Coras R, Torres A, et al. Synovial inflammation in osteoarthritis progression. Nat Rev Rheumatol 2022;18:258-75. [Crossref] [PubMed]
- Chen H, Ni Q, Li B, et al. Identification of differentially expressed genes in synovial tissue of osteoarthritis based on a more robust integrative analysis method. Clin Rheumatol 2021;40:3745-54. [Crossref] [PubMed]
- Cai W, Li H, Zhang Y, et al. Identification of key biomarkers and immune infiltration in the synovial tissue of osteoarthritis by bioinformatics analysis. PeerJ 2020;8:e8390. [Crossref] [PubMed]
- Duan ZX, Li YS, Tu C, et al. Identification of a potential gene target for osteoarthritis based on bioinformatics analyses. J Orthop Surg Res 2020;15:228. [Crossref] [PubMed]
- Zhu Z, Zhong L, Li R, et al. Study of Osteoarthritis-Related Hub Genes Based on Bioinformatics Analysis. Biomed Res Int 2020;2020:2379280. [Crossref] [PubMed]
- Reiner-Benaim A. FDR control by the BH procedure for two-sided correlated tests with implications to gene expression data analysis. Biom J 2007;49:107-26. [Crossref] [PubMed]
- Yuan WH, Xie QQ, Wang KP, et al. Screening of osteoarthritis diagnostic markers based on immune-related genes and immune infiltration. Sci Rep 2021;11:7032. [Crossref] [PubMed]
- Szklarczyk D, Morris JH, Cook H, et al. The STRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res 2017;45:D362-8. [Crossref] [PubMed]
- Hoshi H, Akagi R, Yamaguchi S, et al. Effect of inhibiting MMP13 and ADAMTS5 by intra-articular injection of small interfering RNA in a surgically induced osteoarthritis model of mice. Cell Tissue Res 2017;368:379-87. [Crossref] [PubMed]
- Shi D, Gu R, Song Y, et al. Calcium/Calmodulin-Dependent Protein Kinase IV (CaMKIV) Mediates Acute Skeletal Muscle Inflammatory Response. Inflammation 2018;41:199-212. [Crossref] [PubMed]
- Krenn V, Morawietz L, Burmester GR, et al. Synovitis score: discrimination between chronic low-grade and high-grade synovitis. Histopathology 2006;49:358-64. [Crossref] [PubMed]
- Mankin HJ, Dorfman H, Lippiello L, et al. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with biochemical and metabolic data. J Bone Joint Surg Am 1971;53:523-37. [Crossref] [PubMed]
- Cai L, Lei C, Li R, et al. Overexpression of aquaporin 4 in articular chondrocytes exacerbates the severity of adjuvant-induced arthritis in rats: an in vivo and in vitro study. J Inflamm (Lond) 2017;14:6. [Crossref] [PubMed]
- Dai M, Liu X, Wang N, et al. Squid type II collagen as a novel biomaterial: Isolation, characterization, immunogenicity and relieving effect on degenerative osteoarthritis via inhibiting STAT1 signaling in pro-inflammatory macrophages. Mater Sci Eng C Mater Biol Appl 2018;89:283-94. [Crossref] [PubMed]
- Wang S, Wang H, Liu W, et al. Identification of Key Genes and Pathways Associated with Sex Differences in Osteoarthritis Based on Bioinformatics Analysis. Biomed Res Int 2019;2019:3482751. [Crossref] [PubMed]
- Ayral X, Pickering EH, Woodworth TG, et al. Synovitis: a potential predictive factor of structural progression of medial tibiofemoral knee osteoarthritis -- results of a 1 year longitudinal arthroscopic study in 422 patients. Osteoarthritis Cartilage 2005;13:361-7. [Crossref] [PubMed]
- Wang H, Wang Q, Yang M, et al. Histomorphology and innate immunity during the progression of osteoarthritis: Does synovitis affect cartilage degradation? J Cell Physiol 2018;233:1342-58. [Crossref] [PubMed]
- COHEN S. Isolation of a mouse submaxillary gland protein accelerating incisor eruption and eyelid opening in the new-born animal. J Biol Chem 1962;237:1555-62. [Crossref] [PubMed]
- Zhang YW, Su Y, Lanning N, et al. Targeted disruption of Mig-6 in the mouse genome leads to early onset degenerative joint disease. Proc Natl Acad Sci U S A 2005;102:11740-5. [Crossref] [PubMed]
- Hagiwara K, Shinozaki T, Matsuzaki T, et al. Immunolocalization of water channel aquaporins in human knee articular cartilage with intact and early degenerative regions. Med Mol Morphol 2013;46:104-8. [Crossref] [PubMed]
- Zelenina M. Regulation of brain aquaporins. Neurochem Int 2010;57:468-88. [Crossref] [PubMed]
- Naz H, Islam A, Ahmad F, et al. Calcium/calmodulin-dependent protein kinase IV: A multifunctional enzyme and potential therapeutic target. Prog Biophys Mol Biol 2016;121:54-65. [Crossref] [PubMed]
- Sikela JM, Law ML, Kao FT, et al. Chromosomal localization of the human gene for brain Ca2+/calmodulin-dependent protein kinase type IV. Genomics 1989;4:21-7. [Crossref] [PubMed]
- Hanissian SH, Frangakis M, Bland MM, et al. Expression of a Ca2+/calmodulin-dependent protein kinase, CaM kinase-Gr, in human T lymphocytes. Regulation of kinase activity by T cell receptor signaling. J Biol Chem 1993;268:20055-63. [Crossref] [PubMed]
- Koga T, Ichinose K, Mizui M, et al. Calcium/calmodulin-dependent protein kinase IV suppresses IL-2 production and regulatory T cell activity in lupus. J Immunol 2012;189:3490-6. [Crossref] [PubMed]
- Racioppi L, Means AR. Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller. Trends Immunol 2008;29:600-7. [Crossref] [PubMed]
- Lopes EBP, Filiberti A, Husain SA, et al. Immune Contributions to Osteoarthritis. Curr Osteoporos Rep 2017;15:593-600. [Crossref] [PubMed]
- Chemin K, Gerstner C, Malmström V. Effector Functions of CD4+ T Cells at the Site of Local Autoimmune Inflammation-Lessons From Rheumatoid Arthritis. Front Immunol 2019;10:353. [Crossref] [PubMed]
- Glasson SS, Blanchet TJ, Morris EA. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthritis Cartilage 2007;15:1061-9. [Crossref] [PubMed]
- Glasson SS, Askew R, Sheppard B, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature 2005;434:644-8. [Crossref] [PubMed]
- Li R, Guan Z, Bi S, et al. The proton-activated G protein-coupled receptor GPR4 regulates the development of osteoarthritis via modulating CXCL12/CXCR7 signaling. Cell Death Dis 2022;13:152. [Crossref] [PubMed]
- Sato K, Suematsu A, Nakashima T, et al. Regulation of osteoclast differentiation and function by the CaMK-CREB pathway. Nat Med 2006;12:1410-6. [Crossref] [PubMed]
- Zhang X, Wheeler D, Tang Y, et al. Calcium/calmodulin-dependent protein kinase (CaMK) IV mediates nucleocytoplasmic shuttling and release of HMGB1 during lipopolysaccharide stimulation of macrophages. J Immunol 2008;181:5015-23. [Crossref] [PubMed]
- Yong L, Yu Y, Li B, et al. Calcium/calmodulin-dependent protein kinase IV promotes imiquimod-induced psoriatic inflammation via macrophages and keratinocytes in mice. Nat Commun 2022;13:4255. [Crossref] [PubMed]
- Liang W, Li Z, Wang Z, et al. Periodic Mechanical Stress INDUCES Chondrocyte Proliferation and Matrix Synthesis via CaMKII-Mediated Pyk2 Signaling. Cell Physiol Biochem 2017;42:383-96. [Crossref] [PubMed]

