Regulation of endothelial-to-mesenchymal transition by histone deacetylase 3 posttranslational modifications in neointimal hyperplasia
Highlight box
Key findings
• Histone deacetylase 3 (HDAC3) exerts the enzyme activity of deacetylation and decrotonylation to regulate endothelial-to-mesenchymal transition (EndMT) in neointimal hyperplasia.
What is known and what is new?
• HDAC3, a class I HDACs, causes posttranslational modifications, including deacetylation and decrotonylation. Endothelial-derived vascular smooth muscle cells (VSMCs) also contribute to neointimal hyperplasia through EndMT.
• HDAC3 regulates EndMT in neointimal hyperplasia via posttranslational modifications including deacetylation and decrotonylation.
What is the implication, and what should change now?
• This study provides valuable information for the therapeutic benefits of HDAC3 inhibitors in neointimal hyperplasia caused by posttranslational modifications.
Introduction
Endothelial-to-mesenchymal transition (EndMT) is the process by which endothelial cells lose their specific markers and acquire mesenchymal or myofibroblastic phenotypes (1,2). Many studies, including our previous research, have verified that vascular smooth muscle cells (VSMCs) play a key role in the process of neointimal hyperplasia (3-5). Emerging studies demonstrate the importance of EndMT in neointimal hyperplasia, and endothelial-derived VSMCs also contribute to neointimal hyperplasia through EndMT (6,7). It has been reported that, in biomechanical stress-induced pathological vascular remodeling, endothelium-derived cells participate in the formation of neointima lesions through EndMT mediated by the transforming growth factor (TGF)-β signaling pathway (6). It has been demonstrated that TGF-β1 acts on smooth muscle cells (SMCs) of the artery wall to accelerate intima growth (8,9). In addition, vascular inflammation and neointima proliferation are strongly correlated (10). The inflammatory cytokine, tumor necrosis factor (TNF)-α, enhances TGF-β-dependent EndMT, which contributes to tumor progression (11). Therefore, inhibition of TGF-β1- and TNF-α-induced EndMT may provide a novel therapeutic approach for the treatment of neointimal hyperplasia.
Histone deacetylases (HDACs) are important enzymes that affect posttranslational modifications of histone and nonhistone proteins by altering the acetylation state of lysine residues. Posttranslational modifications of the histones in chromatin have a fundamental role in regulating gene expression (12,13). Studies have shown that HDACs can causes a variety of posttranslational modifications, including acetylation, glycosylation, S-nitrosylation, sumoylation, ubiquitination, and phosphorylation, in cardiovascular diseases (14-16). In 2011, crotonylation of the histone lysine was regarded as a new type of posttranslational modification (17). Recently, it was reported that class I HDACs are major cellular histone decrotonylases (18). The HDAC family can be divided into 4 classes, with HDAC3 belonging to the class I HDACs (19). Previous studies have shown that HDAC3 plays a key role in heart development (20,21), and there is a growing amount of evidence suggesting that HDAC3 has a key regulatory function in cardiovascular diseases, including heart failure and atherosclerosis (22,23). It was reported that HDAC inhibition can alleviate neointimal hyperplasia in a murine model of vascular injury (15,24). Recent studies have proven that endothelial-derived VSMCs are also important factors responsible for neointimal hyperplasia (6,7). However, the effect of HDAC3 on EndMT in neointimal hyperplasia via posttranslational modifications remains unknown.
Therefore, in this study, we first determined the effects of TGF-β1 and TNF-α on EndMT and HDAC3 in human umbilical vein endothelial cells (HUVECs). Subsequently, the regulatory effect of HDAC3 on EndMT and the underlying posttranslational modifications in neointimal hyperplasia were investigated in ligated carotid arteries of mice and HUVECs. We present the following article in accordance with the ARRIVE reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4371/rc).
Methods
Cell culture and treatment
HUVECs were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). HUVECs were grown in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS; Gibco) at 37 ℃ in a 5% CO2, fully humidified atmosphere. Cells were passaged 3 times weekly, and exponentially growing cells were used in the experiments.
To investigate the effects of TGF-β1 (PeproTech, Rocky Hill, NJ, USA) on EndMT and HDAC3, HUVECs were treated with TGF-β1 at different concentrations (0, 2.5, 5, 10, and 20 ng/mL) for 24 h. And HUVECs were stimulated with TGF-β1 (10 ng/mL) at different durations (24, 48, and 72 h). In order to test whether the EndMT and HDAC3 was induced by inflammatory cytokines in HUVECs, the cells were treated with the proinflammatory cytokine TNF-α (PeproTech) at concentrations of 5, 10, 20, and 40 ng/mL for 24 h. Furthermore, HUVECs were treated with TNF-α (10 ng/mL) for 24, 48, and 72 h. In the above studies, cells treated with serum-free DMEM/F12 was the control group. To determine whether the regulatory effect of HDAC3 on EndMT is mediated by posttranslational modifications, HUVECs were pretreated with HDAC3-selective inhibitor RGFP966 (Selleck Chemicals, Houston, TX, USA) at the concentration of 10 µmol/L for 1 h, and then co-treated with TNF-α (10 ng/mL) and IL-1β (10 ng/mL) for 24 h. In this study, RGFP966 was dissolved in dimethyl sulfoxide (DMSO; MilliporeSigma, Burlington, MA, USA) and DMSO served as a control.
Animal experiments
The animal experiments were approved by the Experimental Animal Ethics Committee of Xi’an Jiaotong University (Ethics No. 2018-235) and performed according to the National Institutes of Health Guide for Care and Use of Laboratory Animals. A protocol was prepared prior to the study without registration. Male C57BL/6J mice (8 weeks old) were obtained from the Laboratory Animal Center of Xi’an Jiaotong University (Xi’an, Shaanxi, China). Animals were handled and housed under specific pathogen-free (SPF) conditions under a standard 12-h light/dark cycle. The temperature of the housing room was within the expected normal range (22–26 ℃).
To investigate the effects of HDAC3 on EndMT in neointimal hyperplasia, mice were subjected to left carotid artery ligation. The right carotid arteries in mice underwent the same surgical procedure, but without ligation. In addition, the mice were injected with the HDAC3-selective inhibitor RGFP966 (10 mg/kg body weight, i.p; Selleck Chemicals) or vehicle 1 day prior to surgery and then for 14 days after surgery (n=8 per group). RGFP966 was dissolved in DMSO (MilliporeSigma), polyethylene glycol 300 and Tris-buffered saline Tween-80 (Sinopharm Chemical Reagent Co., Ltd, Suzhou, Jiangsu, China). The vehicle (5% DMSO + 40% PEG300 + 5% Tween-80 + 50% normal saline) served as a control. On day 14 after carotid artery ligation or sham surgery, mice were killed with an overdose intraperitoneal injection of pentobarbital. The carotid arteries were harvested and then embedded directly in optimal cutting temperature compound (OCT; Sakura Finetek, Tokyo, Japan) for cryostat sectioning. Sections were subjected to hematoxylin and eosin (HE) and immunofluorescence staining for routine analysis. The carotid arteries from other mice were used for analysis of messenger RNA (mRNA) expression.
Quantitative real-time polymerase chain reaction (PCR)
Total RNA in tissues and cells was extracted using TRIzol reagent, and mRNA was reverse-transcribed into complement DNA (cDNA) using a reverse transcription kit (Takara Bio, Shiga, Japan). Quantitative real-time PCR was performed using the iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Target gene expression was quantified relative to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which was used as an internal control, based on a comparison of the threshold cycle (CT) at constant fluorescence intensity. Expression results were calculated using the ΔΔCT method and were normalized against the reference gene GAPDH. Primer pair sequences are provided in Table 1.
Table 1
| Gene | Primer sequence (5'–3') |
|---|---|
| Mouse CD31 | Forward: CTGCTCCACTTCTGAACTCC |
| Reverse: TACATCCATGTTCTGGGGGT | |
| Mouse VE-cadherin | Forward: CCACTGCTTTGGGAGCCTT |
| Reverse: GGCAGGTAGCATGTTGGGG | |
| Mouse vWF | Forward: CTCTTTGGGGACGACTTCATC |
| Reverse: TCCCGAGAATGGAGAAGGAAC | |
| Mouse SM22α | Forward: CCAACAAGGGTCCATCCTACG |
| Reverse: ATCTGGGCGGCCTACATCA | |
| Mouse α-SMA | Forward: GGCACCACTGAACCCTAAGG |
| Reverse: ACAATACCAGTTGTACGTCCAGA | |
| Mouse FSP-1 | Forward: TGAGCAACTTGGACAGCAACA |
| Reverse: CTTCTTCCGGGGCTCCTTATC | |
| Mouse IL-18 | Forward: GCCATGTCAGAAGACTCTTGCGTC |
| Reverse: GTACAGTGAAGTCGGCCAAAGTTGTC | |
| Mouse IL-1β | Forward: CTGTGTCTTTCCCGTGGACC |
| Reverse: CAGCTCATATGGGTCCGACA | |
| Mouse GAPDH | Forward: AGGTCGGTGTGAACGGATTTG |
| Reverse: GGGGTCGTTGATGGCAACA | |
| Human CD31 | Forward: GAGTCCAGCCGCATATCC |
| Reverse: TGACACAATCGTATCTTCCTTC | |
| Human α-SMA | Forward: CCTTCACTCGGACACACTCA |
| Reverse: GCCATGTTCTATCGGGTACTTC | |
| Human HDAC3 | Forward: CCTGGCATTGACCCATAGCC |
| Reverse: CTCTTGGTGAAGCCTTGCATA | |
| Human GAPDH | Forward: GGAGCGAGATCCCTCCAAAAT |
| Reverse: GGCTGTTGTCATACTTCTCATGG |
CD31, platelet endothelial cell adhesion molecule-1; VE-cadherin, vascular endothelial-cadherin; vWF, von Willebrand Factor; SM22α, smooth muscle protein 22-α; α-SMA, α-smooth muscle actin; FSP-1, fibroblast-specific protein-1; IL, interleukin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HDAC3, histone deacetylase 3.
Histone extraction
Total histone proteins were extracted from cultured HUVECs using a histone extraction kit (EpiGentek, Farmingdale, NY, USA) according to the manufacturer’s instructions. Briefly, cells were detached from plates and lysed in the 1× diluted prelysis buffer on ice for 10 min. The cells were then centrifuged at 861 g rpm for 5 min at 4 ℃, and the supernatant was discarded. The cells were then resuspended in lysis buffer and incubated on ice for 30 min, after which the cell suspension was centrifuged at 13,778 g for 5 min at 4 ℃. Finally, the supernatant containing acid-soluble proteins was transferred to a new vial, and 0.3 volumes of balance buffer supplemented with dithiothreitol (balance-DTT) buffer was added and mixed. Protein concentration and solubility were measured using a BCA kit (Beyotime, Nanjing, China).
Western blotting
Total proteins were isolated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (PVDF; MilliporeSigma) for Western blotting. The PVDF membranes were blocked with 5% milk for 1 h at room temperature. After treatment, the membranes were incubated overnight with the primary antibodies at 4 ℃. The primary antibodies used were as follows: anti-CD31 (1:500; Abcam, Cambridge, UK), anti-α-smooth muscle actin (SMA; 1:2,000; ImmunoWay, Plano, TX, USA), anti-HDAC3 (1:1,000; Cell Signaling Technology, Danvers, MA, USA), pan-anti-acetylated lysine and pan-anti-crotonylated lysine (1:500; PTM Biolabs, Hangzhou, Zhejiang, China), anti-β-actin (1:1,000; CMCTAG, Dover, DE, USA). The membranes were then washed 3 times for 10 min with Tris-buffered saline Tween-20 (TBST) buffer and incubated with horseradish peroxidase-conjugated secondary antibodies (1:10,000; Signalway Antibody, Baltimore, MD, USA) for 2 h at room temperature. The membranes were then washed 3 times for 10 min in TBST before being incubated with enhanced chemiluminescence (ECL) detection reagent (MilliporeSigma) and scanned using an ECL detection system.
Immunofluorescence
Fixed cells and tissue sections were washed in phosphate-buffered saline with 0.1% Tween-20, infiltrated with a solution of 0.3% Triton X-100 for 30 min, and blocked in 10% goat serum at room temperature for 1 h. Primary antibodies were applied overnight at 4 ℃. The primary antibodies used were as follows: anti-CD31 (1:100; Abcam), anti-α-SMA (1:200; Abcam), pan-anti-acetylated lysine and pan-anti-crotonylated lysine (1:50; PTM Biolabs), and anti-HDAC3 (1:100; Cell Signaling Technology). The samples were then stained with a fluorescein isothiocyanate-labeled immunoglobin G (IgG) antibody (1:200; Jackson ImmunoResearch, West Grove, PA, USA) and Cy3-labeled IgG (1:200; Beyotime). Nuclei were stained with 4’,6’-diamidino-2-phenylindole (1:1,000; Beyotime) for 10 min. Finally, cells were photographed and visualized under a fluorescence microscope (Leica, Wetzlar, Germany). The mean fluorescence intensity was measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Statistical analysis
All data are presented as the mean ± standard error of the mean (SEM) from 3 independent experiments. Statistical significance was determined by Student t-test and 1-way analysis of variance. The two-tailed P<0.05 was considered statistically significant.
Results
TGF-β1 induced EndMT in HUVECs
To investigate the effects of TGF-β1 on EndMT, HUVECs were treated with different concentrations of TGF-β1 at different durations. Protein expression of the endothelial marker CD31 was decreased, whereas that of mesenchymal marker α-SMA was increased, with increasing concentrations of TGF-β1 compared with the control group (Figure 1A,1B). Quantitative real-time PCR revealed that TGF-β1 reduced CD31 mRNA expression and augmented α-SMA mRNA expression in HUVECs (Figure 1C,1D). Further studies were performed to verify the duration of the effect of TGF-β1 (10 ng/mL) on EndMT in HUVECs. There was an obvious difference in the protein expression of CD31 and α-SMA at different durations (24, 48, and 72 h) between the TGF-β1-treated and control groups (P<0.01; Figure 1E,1F). Together, these results reveal that TGF-β1 induces EndMT in HUVECs.
Inflammatory cytokine promoted EndMT in HUVECs
To test whether the EndMT was induced by inflammatory cytokines in HUVECs, the cells were treated with the proinflammatory cytokine TNF-α at different concentrations. With the increasing concentrations of TNF-α, protein expression of the endothelial marker CD31 decreased, whereas that of the mesenchymal marker α-SMA increased (Figure 2A,2B). Similar results were obtained for CD31 and α-SMA mRNA expression in HUVECs stimulated by different concentrations of TNF-α (Figure 2C,2D).
Using a fluorescence microscope, we clearly observed that the fluorescence intensity of CD31 was greatly attenuated in the TNF-α-treated compared with control group (P<0.01; Figure 2E,2F). We further studied the time course of the effects of TNF-α on CD31 and α-SMA expression in HUVECs by treating the cells with 10 ng/mL TNF-α at different durations. There was a significant difference in CD31 and α-SMA protein expression at different durations (24, 48, and 72 h) between the TNF-α-treated and control groups (P<0.01; Figure 2G,2H). Together, these results suggest that inflammatory cytokines also promote EndMT, such that endothelial cells lose their original characteristics and turn into cells with mesenchymal phenotypes.
TGF-β1 increased the expression of HDAC3 in HUVECs
To confirm the effect of TGF-β1 on HDAC3, HUVECs were treated with TGF-β1 at different concentrations and for different periods of time. We first determined levels of HDAC3 protein and mRNA expression in HUVECs treated with TGF-β1 at different concentrations for 24 h. Different concentrations of TGF-β1 increased HDAC3 protein expression compared with control (Figure 3A), and HDAC3 mRNA expression increased gradually with increasing concentrations of TGF-β1 (Figure 3B). Furthermore, treatment of HUVECs with 10 ng/mL of TGF-β1 for 24, 48, and 72 h increased HDAC3 protein levels (Figure 3C,3D). The results indicated that HDAC3 expression in HUVECs increased with increasing TGF-β1 concentrations and treatment times.
Inflammatory cytokine upregulated the expression of HDAC3 in HUVECs
To confirm whether HDAC3 expression could be affected by inflammatory cytokines, HUVECs were stimulated with TNF-α and were then processed for fluorescence staining. At 10 and 20 ng/mL, TNF-α enhanced the mean fluorescence intensity of HDAC3 compared with the control group (P<0.05; Figure 4A,4B). To explore the time course of HDAC3 expression, cells were treated with 10 ng/mL of TNF-α at different durations, and the expression level of HDAC3 was detected with Western blotting. There was a significant difference in HDAC3 protein expression at different durations (24, 48 h) between the TNF-α-treated and control group (P<0.01; Figure 4C,4D). Based on these results, we believe that inflammatory cytokines upregulate HDAC3 expression.
HDAC3-selective inhibitor suppressed EndMT in neointimal hyperplasia
HE staining was used to demonstrate neointimal hyperplasia in the carotid arteries of mice in each group. HE staining revealed that treatment with the HDAC3-selective inhibitor RGFP966 significantly alleviated neointimal hyperplasia after ligation compared with vehicle treatment (Figure 5A). Then, quantitative real-time PCR was used to detected the gene expression of inflammatory cytokines and EndMT markers in the carotid arteries. A significant decrease in interleukin-1β (IL-1β) and interleukin-18 (IL-18) mRNA levels was found in the RGFP966-treated group compared with the vehicle-treated group (Figure 5B,5C). In addition, RGFP966 treatment increased the expression of endothelial markers CD31, von Willebrand Factor (vWF), vascular endothelial-cadherin (VE-cadherin) and decreased the expression of mesenchymal markers (α-SMA), smooth muscle protein 22-α (SM22α), fibroblast-specific protein-1 (FSP-1) in ligated arteries compared with vehicle treatment (Figure 5D,5E). Next, using immunofluorescence staining, we investigated whether EndMT was induced in intimal hyperplasia. In ligated arteries, RGFP966 treatment increased the fluorescence intensity of CD31 in the hyperplastic intima but decreased α-SMA fluorescence compared with vehicle treatment (Figure 5F-5H). Therefore, wed conclude that the HDAC3-selective inhibitor RGFP966 suppresses EndMT and ameliorates neointimal hyperplasia in mice.
HDAC3 regulated EndMT via posttranslational modifications
To determine whether the regulatory effect of HDAC3 on EndMT is mediated by posttranslational modifications, HUVECs were cultured with TGF-β1 or TNF-α. First, the total cellular proteins were subjected to Western blotting using pan–anti-acetylated lysine antibody and pan-anti-crotonylated lysine antibody. Groups treated with TGF-β1 and TNF-α had greater the acetylation and crotonylation of proteins in HUVECs compared with the control group. In particular, the crotonylation level of proteins was obviously decreased in HUVECs treated with TGF-β1 and TNF-α (Figure 6A,6B). Moreover, the HDAC3-selective inhibitor RGFP966 increased the acetylation and crotonylation of histones compared with the effects of TNF-α and IL-1β (Figure 6C,6D).
To further confirm the effect of HDAC3 posttranslational modifications, we examined the acetylation and crotonylation levels of histone proteins. There was a more obvious difference in histone protein crotonylation than acetylation between the RGFP966- and inflammatory cytokine (TNF-α and IL-1β)-treated groups (Figure 6E). Immunofluorescence staining was also used to detect levels of acetylation and crotonylation in the carotid arteries of mice. Following carotid artery ligation, the mean fluorescence intensities of acetylation and crotonylation in neointimal hyperplasia were increased with RGFP966 treatment compared with vehicle treatment (Figure 6F-6I). These results suggest that HDAC3 regulates EndMT via modulation of posttranslational modifications, including acetylation and crotonylation.
Discussion
Most studies of neointimal hyperplasia have focused on inhibiting VSMC proliferation and migration (3-5). Emerging studies demonstrate the importance of endothelial-derived VSMCs through EndMT in neointimal hyperplasia (6,7). Recent studies have shown that HDAC3 causes posttranslational modifications including deacetylation and decrotonylation (25-27). The present study provides first-hand evidence demonstrating a novel role for HDAC3 in regulating EndMT during neointimal hyperplasia via posttranslational modifications.
Previous studies have verified that VSMCs play an important role in the process of neointimal hyperplasia (3-5). This was recently confirmed with lineage tracing to study the contribution of different cell types to neointima formation during vein graft remodeling (6). It was established that 51.7%±3.3% (mean ± SEM) of neointimal cells were of endothelial origin and that EndMT is a central component of neointimal hyperplasia in mice (6). In the process of EndMT, endothelial cells lose cell-cell junctions and acquire a mesenchymal cell-like phenotype (1,2). A growing body of evidence supports the importance of TGF-β signaling in EndMT (28). In the present study, TGF-β1 induced EndMT in HUVECs. Liang et al. reported that anti-TGF-β antibody treatment prevented EndMT in ligated carotid arteries of mice fed a high-fat diet (29). In addition, studies have shown that the inflammatory cytokine TNF-α enhances TGF-β-dependent EndMT and neointimal proliferation (10,11). In the present study, TNF-α promoted EndMT in HUVECs, as demonstrated by a decrease in the fluorescence intensity and protein expression of the endothelial marker CD31 and by an increase in α-SMA expression. These results suggest that both the growth factor and inflammatory cytokine contribute to the EndMT process in HUVECs.
Recent studies reported that HDAC3 plays a key regulatory role in cardiovascular diseases (22,23). In a previous study, we found that HDAC3 expression was upregulated and EndMT occurred in the aortas of apolipoprotein E-null (ApoE−/−) mice and HUVECs (30). In the present study, both TGF-β1 and TNF-α increased HDAC3 expression in HUVECs. It has been reported that HDAC3 is essential for the survival of endothelial cells under conditions of shear stress and that knockdown of HDAC3 aggravates neointima formation (31). Therefore, we speculated that HDAC3 may regulate EndMT in neointimal hyperplasia. In a further in vivo experiment, we found that the HDAC3-selective inhibitor RGFP966 alleviated neointimal hyperplasia and EndMT in the ligated carotid arteries of mice. In a previous in vitro study, HDAC3 inhibition suppressed EndMT, whereas HDAC3 overexpression aggravated EndMT in HUVECs (30). It is interesting to note that the HDAC inhibitor trichostatin A reduced neointimal hyperplasia in a rat carotid injury model (24). In a previous study, we showed that the HDAC3 inhibitor RGFP966 suppressed EndMT and reduced the development of atherosclerosis in ApoE−/− mice (30). Together, these findings indicate that HDAC3 inhibition regulates EndMT in neointimal hyperplasia.
It is well known that HDAC3 is a class I HDAC. HDAC3 deacetylates histone and nonhistone proteins (13). It has been proven that the inhibition of HDAC3 exerts a protective effect in cardiovascular diseases through the modification of deacetylation (14-16). It is likely that this cardioprotection is mediated primarily by the epigenetic regulation of the dual specificity phosphatase 5 (DUSP5)/extracellular signal-regulated kinase 1/2 pathway via acetylation of histone H3 on the DUSP5 gene promoter (32). Li et al. showed that β-hydroxybutyrate inhibited HDAC3 and caused acetylation of H3K14 in the claudin-5 promoter, thereby promoting claudin-5 generation and antagonizing diabetes-associated cardiac microvascular hyperpermeability (33). In the present study, both TGF-β1 and TNF-α not only induced EndMT, but also changed the acetylation level of proteins in HUVECs. Furthermore, the HDAC3-selective inhibitor RGFP966 not only increased the acetylation level of histones in HUVECs, but also enhanced the fluorescence intensity of acetylation in the hyperplastic intima of mice. Another study showed that HDAC3 inhibits aspirin-induced endothelial nitric oxide (NO) production by deacetylating aspirin-acetylated endothelial NO synthase (16). Zeng et al. found that RGFP966 increased peroxisome proliferator-activated receptor activity by promoting its acetylation, thereby reducing vascular dysfunction in neurological disorders (34).
It was recently discovered that HDAC3 exerts the enzyme activity of decrotonylation (25). Histone crotonylation was initially found in the intestine, and HDAC inhibitors, including the gut microbiota-derived butyrate, affect histone decrotonylation (26). However, the effects of HDAC3 on protein crotonylation in pathophysiologic processes of cardiovascular diseases remain unknown. In the present study, both TGF-β1 and TNF-α decreased the crotonylation level of proteins. Moreover, there was a more obvious difference in histone crotonylation than in acetylation in mice treated with the HDAC3 inhibitor. Further investigation in mice found that RGFP966 treatment increased the crotonylation level in neointimal hyperplasia. Importantly, a recent study found that short-chain enoyl-coenzyme A hydratase mediates histone crotonylation and contributes to cardiac homeostasis (27). Together, the above findings suggest that HDAC3 regulates EndMT via modulation of posttranslational modifications including acetylation and crotonylation.
Conclusions
In summary, our results reveal that EndMT induced by TGF-β1 and TNF-α is involved in neointimal hyperplasia. HDAC3 regulates EndMT in neointimal hyperplasia through deacetylation and decrotonylation. Although the histone and nonhistone proteins that HDAC3 regulated via posttranslational modifications in the process of EndMT need further investigation, the present findings provide valuable information of the therapeutic benefit of an HDAC3 inhibitor in neointimal hyperplasia. Further studies are ongoing to identify specific proteins that HDAC3 regulates via deacetylation and decrotonylation modifications.
Acknowledgments
Funding: This study was supported by the National Natural Science Foundation of China (No. 81873520) and the Innovation Capability Support Program of Shaanxi grants (No. 2023-CX-PT-07).
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4371/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4371/dss
Peer Review File: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4371/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4371/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The animal experiments were approved by the Experimental Animal Ethics Committee of Xi’an Jiaotong University (Ethics No. 2018-235) and performed according to the National Institutes of Health Guide for Care and Use of Laboratory Animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Chu T, Li Q, Dai C, et al. A novel Nanocellulose-Gelatin-AS-IV external stent resists EndMT by activating autophagy to prevent restenosis of grafts. Bioact Mater 2023;22:466-81. [Crossref] [PubMed]
- Kovacic JC, Mercader N, Torres M, et al. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation 2012;125:1795-808. [Crossref] [PubMed]
- Wang S, Liu X, Meng Z, et al. DCBLD2 regulates vascular hyperplasia by modulating the platelet derived growth factor receptor-β endocytosis through Caveolin-1 in vascular smooth muscle cells. FASEB J 2022;36:e22488. [Crossref] [PubMed]
- Yang F, Chen Q, He S, et al. miR-22 Is a Novel Mediator of Vascular Smooth Muscle Cell Phenotypic Modulation and Neointima Formation. Circulation 2018;137:1824-41. [Crossref] [PubMed]
- Wang W, Chen L, Shang C, et al. miR-145 inhibits the proliferation and migration of vascular smooth muscle cells by regulating autophagy. J Cell Mol Med 2020;24:6658-69. [Crossref] [PubMed]
- Cooley BC, Nevado J, Mellad J, et al. TGF-β signaling mediates endothelial-to-mesenchymal transition (EndMT) during vein graft remodeling. Sci Transl Med 2014;6:227ra34. [Crossref] [PubMed]
- Zhang M, Wang B, Urabe G, et al. The BD2 domain of BRD4 is a determinant in EndoMT and vein graft neointima formation. Cell Signal 2019;61:20-9. [Crossref] [PubMed]
- Majesky MW, Lindner V, Twardzik DR, et al. Production of transforming growth factor beta 1 during repair of arterial injury. J Clin Invest 1991;88:904-10. [Crossref] [PubMed]
- Nabel EG, Shum L, Pompili VJ, et al. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia. Proc Natl Acad Sci U S A 1993;90:10759-63. [Crossref] [PubMed]
- Chen CY, Leu HB, Wang SC, et al. Inhibition of Trimethylamine N-Oxide Attenuates Neointimal Formation Through Reduction of Inflammasome and Oxidative Stress in a Mouse Model of Carotid Artery Ligation. Antioxid Redox Signal 2023;38:215-33. [Crossref] [PubMed]
- Yoshimatsu Y, Wakabayashi I, Kimuro S, et al. TNF-α enhances TGF-β-induced endothelial-to-mesenchymal transition via TGF-β signal augmentation. Cancer Sci 2020;111:2385-99. [Crossref] [PubMed]
- de Ruijter AJ, van Gennip AH, Caron HN, et al. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem J 2003;370:737-49. [Crossref] [PubMed]
- Neganova ME, Klochkov SG, Aleksandrova YR, et al. Histone modifications in epigenetic regulation of cancer: Perspectives and achieved progress. Semin Cancer Biol 2022;83:452-71. [Crossref] [PubMed]
- Eom GH, Kook H. Posttranslational modifications of histone deacetylases: implications for cardiovascular diseases. Pharmacol Ther 2014;143:168-80. [Crossref] [PubMed]
- Findeisen HM, Gizard F, Zhao Y, et al. Epigenetic regulation of vascular smooth muscle cell proliferation and neointima formation by histone deacetylase inhibition. Arterioscler Thromb Vasc Biol 2011;31:851-60. [Crossref] [PubMed]
- Jung SB, Kim CS, Naqvi A, et al. Histone deacetylase 3 antagonizes aspirin-stimulated endothelial nitric oxide production by reversing aspirin-induced lysine acetylation of endothelial nitric oxide synthase. Circ Res 2010;107:877-87. [Crossref] [PubMed]
- Tan M, Luo H, Lee S, et al. Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 2011;146:1016-28. [Crossref] [PubMed]
- Xu W, Wan J, Zhan J, et al. Global profiling of crotonylation on non-histone proteins. Cell Res 2017;27:946-9. [Crossref] [PubMed]
- Gregoretti IV, Lee YM, Goodson HV. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol 2004;338:17-31. [Crossref] [PubMed]
- Lewandowski SL, Janardhan HP, Trivedi CM. Histone Deacetylase 3 Coordinates Deacetylase-independent Epigenetic Silencing of Transforming Growth Factor-β1 (TGF-β1) to Orchestrate Second Heart Field Development. J Biol Chem 2015;290:27067-89. [Crossref] [PubMed]
- Lewandowski SL, Janardhan HP, Smee KM, et al. Histone deacetylase 3 modulates Tbx5 activity to regulate early cardiogenesis. Hum Mol Genet 2014;23:3801-9. [Crossref] [PubMed]
- Trivedi CM, Lu MM, Wang Q, et al. Transgenic overexpression of Hdac3 in the heart produces increased postnatal cardiac myocyte proliferation but does not induce hypertrophy. J Biol Chem 2008;283:26484-9. [Crossref] [PubMed]
- Hoeksema MA, Gijbels MJ, Van den Bossche J, et al. Targeting macrophage Histone deacetylase 3 stabilizes atherosclerotic lesions. EMBO Mol Med 2014;6:1124-32. [Crossref] [PubMed]
- Kee HJ, Kwon JS, Shin S, et al. Trichostatin A prevents neointimal hyperplasia via activation of Krüppel like factor 4. Vascul Pharmacol 2011;55:127-34. [Crossref] [PubMed]
- Wei W, Liu X, Chen J, et al. Class I histone deacetylases are major histone decrotonylases: evidence for critical and broad function of histone crotonylation in transcription. Cell Res 2017;27:898-915. [Crossref] [PubMed]
- Fellows R, Denizot J, Stellato C, et al. Microbiota derived short chain fatty acids promote histone crotonylation in the colon through histone deacetylases. Nat Commun 2018;9:105. [Crossref] [PubMed]
- Tang X, Chen XF, Sun X, et al. Short-Chain Enoyl-CoA Hydratase Mediates Histone Crotonylation and Contributes to Cardiac Homeostasis. Circulation 2021;143:1066-9. [Crossref] [PubMed]
- van Meeteren LA, ten Dijke P. Regulation of endothelial cell plasticity by TGF-β. Cell Tissue Res 2012;347:177-86. [Crossref] [PubMed]
- Liang G, Wang S, Shao J, et al. Tenascin-X Mediates Flow-Induced Suppression of EndMT and Atherosclerosis. Circ Res 2022;130:1647-59. [Crossref] [PubMed]
- Chen L, Shang C, Wang B, et al. HDAC3 inhibitor suppresses endothelial-to-mesenchymal transition via modulating inflammatory response in atherosclerosis. Biochem Pharmacol 2021;192:114716. [Crossref] [PubMed]
- Zampetaki A, Zeng L, Margariti A, et al. Histone deacetylase 3 is critical in endothelial survival and atherosclerosis development in response to disturbed flow. Circulation 2010;121:132-42. [Crossref] [PubMed]
- Xu Z, Tong Q, Zhang Z, et al. Inhibition of HDAC3 prevents diabetic cardiomyopathy in OVE26 mice via epigenetic regulation of DUSP5-ERK1/2 pathway. Clin Sci (Lond) 2017;131:1841-57. [Crossref] [PubMed]
- Li B, Yu Y, Liu K, et al. β-Hydroxybutyrate inhibits histone deacetylase 3 to promote claudin-5 generation and attenuate cardiac microvascular hyperpermeability in diabetes. Diabetologia 2021;64:226-39. [Crossref] [PubMed]
- Zeng L, Xiao Q, Margariti A, et al. HDAC3 is crucial in shear- and VEGF-induced stem cell differentiation toward endothelial cells. J Cell Biol 2006;174:1059-69. [Crossref] [PubMed]
(English Language Editors: N. Korszniak and J. Jones)

