α-ionone promotes keratinocyte functions and accelerates epidermal barrier recovery
Highlight box
Key findings
• α-ionone promotes keratinocyte functions via activation of the cAMP signaling pathway and accelerates the epidermal barrier recovery of human skin after barrier disruption by tape stripping.
What is known?
• α-ionone attenuates high-fat diet-induced skeletal muscle wasting in mice via activation of cAMP signaling.
• α-ionone protects against UVB-induced photoaging in human dermal fibroblasts.
What is new?
• α-ionone promotes the proliferation and migration of HaCaT cells via activation of the cAMP signaling pathway.
• α-ionone increases HAS2/3 expression and enhances HA production in HaCaT cells via the cAMP signaling pathway.
• α-ionone increases HBD-2 expression and production in HaCaT cells via the cAMP signaling pathway
• Topical application of α-ionone accelerates the epidermal barrier recovery of human skin after barrier disruption by tape stripping.
What is the implication, and what should change now?
• α-ionone has therapeutic potential for the treatment of skin barrier disruption and additional research is needed to further determine this potential.
Introduction
The skin is the largest human organ and forms a protective barrier for the body, preventing excess water loss and protecting against external assailants (1,2). Much of this barrier function is provided by the epidermis, the outer layer of skin. The epidermis is a stratified epithelium that undergoes continuous self-renewal. Keratinocytes in the inner basal layer proliferate and gradually migrate upwards and undergo progressive differentiation to form the outer layers, including spinous, granular, and cornified layers. The most superficial cornified layers (stratum corneum) are continuously shed by desquamation and replaced by differentiating keratinocytes (3-5). The maintenance of epidermal barrier homeostasis requires the balanced activities of keratinocyte proliferation, migration, and differentiation (6,7).
As the outermost barrier of the body, the skin is subjected to daily assaults from the external environment, which results in tissue injury and barrier damage (8-10). Upon skin injury, a series of homeostatic processes are immediately activated to repair the injury and restore skin barrier function. These processes are highly coordinated by complex interplay between various types of cells, extracellular matrix molecules, and mediators (11-13). As the major cell type in the epidermis, keratinocytes play multifaceted critical roles in wound repair. At wound edges, keratinocytes are stimulated to migrate and proliferate to enable skin re-epithelialization, which is crucial for rapid wound healing. To restore the functional epidermal barrier, proliferation is followed by differentiation of the neoepithelium into a stratified epidermis (1,14). Moreover, keratinocyte-derived antimicrobial peptide human β-defensins (HBDs) play a pleiotropic role in the wound healing process. In addition to their well-recognized antimicrobial activity, the skin-derived HBDs also promotes keratinocyte proliferation and migration to initiate the wound healing process (15-18). Hyaluronic acid (HA) synthesized by hyaluronic acid synthases (HAS) in keratinocytes is also involved in the regulation of keratinocyte migration and proliferation in wound healing (19-22). Therefore, enhancing the wound healing-related functional activities of keratinocytes offers a potential means of promoting skin damage repair and strengthening skin barrier function.
α-ionone is a natural aromatic compound present in flowers, fruits, and vegetables. Currently, it is widely used as a fragrance ingredient in food, cosmetics, perfumes, and hygiene products (23,24). Its worldwide usage is in the region of 100–1,000 metric tons per annum. Human skin comes into frequent contact with this odorant, which warrants further investigation into its impact on the skin (25). However, information on its biological property is still limited. Previous studies have reported that α-ionone has bioactivities such as antioxidant, antimicrobial, anti-pest, and allelopathic activities (26). Of note, α-ionone has been shown to stimulate myogenesis in cultured skeletal myotubes and attenuate high-fat diet-induced skeletal muscle wasting in mice via activation of cAMP signaling (27). Furthermore, α-ionone has recently been demonstrated to be able to inhibit UVB-induced loss of collagen in human dermal fibroblasts through upregulating the expression of molecules related to collagen synthesis (TGF-β1, phospho-SMAD2/3, COL1A1, and COL1A2), and suppressing the expression of molecules related to collagen degradation (phospho-p38, phospho-JNK, phospho-ERK, phospho-c-Fos, phospho-c-Jun, MMP1, MMP3, and MMP9). In addition, α-ionone treatment also increased HA contents and upregulated the expression of genes involved in hyaluronic acid synthesis (HAS1 and HAS2) in UVB-irradiated human dermal fibroblasts. These findings suggest that α-ionone could protect human dermal fibroblasts from UVB-induced photoaging through preventing UVB-induced decrease of collagen and HA in human dermal fibroblasts (28). Nevertheless, its effects on keratinocytes have not been investigated. As the predominant cell type of the epidermis, keratinocytes play a pivotal role in skin barrier repair. In present study, we investigated the possible effect of α-ionone on keratinocyte functions associated with skin barrier repair and further evaluated its skin barrier recovery capacity to explore its therapeutic potential for the treatment of skin barrier disruption. We present the following article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-23-1239/rc).
Methods
Reagents
α-ionone were obtained from Zhejiang NHU Co., Ltd. (Xinchang, China). Stock solution of α-ionone (100 mM) was prepared in dimethyl sulfoxide (DMSO) and stored at −20 ℃. The dilutions were prepared with the culture medium directly before use (maximum DMSO final concentration was 0.1%). In our preliminary study, we found that the stimulating effect of α-ionone (1, 10, 20, 50, or 100 µM) on the proliferation of HaCaT cells was concentration-dependent and reached the maximum at 50 µM. We therefore used 10–50 µM as the concentrations of α-ionone for cell experiments. The cAMP inhibitor SQ22536 was obtained from Sigma-Aldrich (St. Louis, MO, USA). For the blocker experiments, 100 µM SQ22536 was co-applied with α-ionone. Other chemical substances were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless stated otherwise.
Cell culture
HaCaT cells were purchased from Zhong Qiao Xin Zhou Biotechnology Co., Ltd. (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Sigma-Aldrich, USA), supplemented with 10% fetal bovine serum (FBS; Gibco, Life Technologies Corp., Grand Island, NY, USA) and 1% penicillin/streptomycin in a cell incubator at 37 ℃ and 5% CO2.
Cell proliferation assay
HaCaT cells were plated in a 96-well plate at a density of 5×103 cells/well and incubated for 24 hours. α-ionone was then added to the cells and incubated for 24 and 48 hours, respectively. The relative numbers of viable cells were measured with a Cell Counting Kit-8 (CCK-8) assay kit (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Absorbance at a wavelength of 450 nm [optical density 450 (OD450)] was measured using a microplate reader (BioTek Epoch Co., Ltd., Winooski, VT, USA). At least 3 wells were examined for each condition. Cell proliferation rate was expressed relative to that of the control group (0.1% DMSO).
cAMP Glo™ assay
HaCaT cells were seeded in 96-well plates at a density of 5×103 cells/well. After 24 hours, the cells were stimulated for 10 minutes with different concentrations (10, 25, and 50 µM) of α-ionone, of forskolin (10 µM) or solvent (0.1% DMSO) only. Forskolin was used as a positive control and the solvents served as the vehicle control. The cAMP levels in stimulated cells were determined using the cAMP-Glo™ Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions and measured via a plate reader (Packard; PerkinElmer, Waltham, MA, USA).
Cell migration assay
The effect of α-ionone on HaCaT cell migration was analyzed using a scratch wound healing assay. HaCaT cells were seeded onto 6-well tissue culture plates in DMEM supplemented with 10% FBS until confluence. The confluent cell monolayers were scratched using a 20-µL pipette tip, and the cast-off cell were removed by washing gently with phosphate-buffered saline (PBS). Then, the cells were incubated with DMEM containing 0.1% DMSO (vehicle control) or α-ionone at the indicated concentrations at 37 ℃ for 24 hours. The scratched cell layers were monitored at 0, 12, and 24 hours, and 4–8 different positions in the culture dish were photo-documented using a digital camera. The area of the gap was measured using Image J (National Institutes of Health, Bethesda, MD, USA). The cellular migration rate was calculated according to the following equation: migration rate (%) = St/S0 × 100% (S0: the initial gap area, St: cell covered area amid the gap at time).
Quantitative polymerase chain reaction
Total RNA was extracted from HaCaT cells using an RNA isolation kit (Yeasen Biotechnology Co., Ltd., Shanghai, China) according to the manufacturer’s instructions. For each sample, 1 µg total RNA was reverse transcribed using PrimeScript RT reagent Kit (Accurate Biotechnology Co., Ltd., Hunan, China). Quantitative polymerase chain reaction (qPCR) was performed on the quantum Studio 6 real-time PCR system (Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR Green Master Mix (Accurate Biotechnology Co., Ltd., Hunan, China). The sequences of used primers are presented in Table 1. The relative messenger RNA (mRNA) level of each target gene was quantified using the 2−ΔΔCt method and normalized to that of β-actin.
Table 1
| Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
|---|---|---|
| β-actin (human) | GTACGCCAACACAGTGCTG | CGTCATACTCCTGCTTGCTG |
| HAS1 (human) | GTCTCCAGGGAGGGTATTTATTG | TCCTGATCACACAGTAGAAATGG |
| HAS2 (human) | CTGGGACGAAGTGTGGATTATG | CTCCAACCATGGGATCTTCTTC |
| HAS3 (human) | AATTCTCTTCAGCCTCTCTTTCC | GGGGCAGTTCGCTGTCTAGG |
| HBD-1 (human) | TCTGCTGTTTACTCTCTGCTTAC | GGCAGGCAGAATAGAGACATT |
| HBD-2 (human) | GATGCCTCTTCCAGGTGTTT | CCACAGGTGCCAATTTGTTTAT |
qPCR, quantitative polymerase chain reaction.
ELISA
HA and HBD-2 released in the supernatants from non-stimulated or stimulated HaCaT cells with α-ionone for 24 hours were measured with commercially available ELISA kits according to the manufacturer’s instructions. A hyaluronic acid Quantikine ELISA kit (DHYAL0) was purchased from R&D Systems (Minneapolis, MN, USA). The ELISA microplate kit for HBD-2 was purchased from Phoenix Pharmaceuticals, Inc. (Burlingame, CA, USA). Supernatants were stored at −20 ℃ until use for ELISA.
Hydrogel preparation
To prepare the hydrogel for topical application, 0.25 g Carbopol U20 was first mixed in 95 g pure water, heated to 85 ℃ and stirred slowly to achieve a uniform mixture. The pH was adjusted to 7.0 with 10% arginine solution, and the uniform mixture became a hydrogel matrix. After that, 0.4 g p-hydroxyacetophenone and 0.4 g 1,2-hexanediol were dissolved in 5 g water by micro-heating and poured into the hydrogel matrix, and then stirred evenly. To prepare the hydrogel containing α-ionone, 0.1 or 1 g α-ionone was slowly added to the hydrogel matrix and stirred to obtain a uniform mixture containing either 0.1% or 1% α-ionone. These preparations of hydrogel containing α-ionone were referred to as 0.1% α-ionone hydrogel and 1% α-ionone hydrogel.
Human skin barrier recovery experiments
The clinical study was performed to evaluate the effect of topical α-ionone on damaged epidermal barrier. The barrier disruption was established by repeated tape stripping. The α-ionone-containing hydrogens or hydrogen vehicle were then topically applied on the stripped sites. Transepidermal water loss (TEWL) and stratum corneum (SC) hydration was monitored to determine barrier recovery of the stripped sites. Human skin experiments were carried out on the volar forearm of healthy volunteers according to the Declaration of Helsinki (as revised in 2013). The study was reviewed and approved by the institutional review board of Fengxian Hospital Affiliated to the Southern Medical University, Shanghai, China (approval number SL2023-KY-03-01). All volunteers provided written informed consent. The human skin experiments were conducted in the Cosmetics Clinical Evaluation center of Fengxian Hospital. A total of 29 women and 3 men, aged 24–58 years (mean age 41 years), were recruited. On each volar forearm, 4 test areas (3×3 cm) were selected and stripped to disrupt the epidermal barrier using a commercial adhesive tape [Youbiao (Shanghai) Printing Co., Ltd., Shanghai, China]. At each test site, a new piece of tape was applied, pressed on with a finger for 10 seconds, then removed in one swift motion. Each site was stripped 5 times. This stripping procedure was carried out once a day for 3 consecutive days. After the barrier disruption had been achieved by tape-stripping, a topical treatment with 20 mg of 3 different hydrogels (hydrogel vehicle, 0.1% α-ionone hydrogel, and 1% α-ionone hydrogel) was performed once daily to day 7. One stripped site was left untreated as the “Tape-stripped only” control. Skin barrier function was evaluated by measurement of TEWL and SC hydration using a VapoMeter (Delfin, Kuopio, Finland) and a Corneometer CM 825 (CK Electronic GmbH, Köln, Germany), respectively. The percentage recovery was calculated using the following formula: (TEWL immediately after barrier disruption − TEWL at indicated time point)/(TEWL immediately after barrier disruption − baseline TEWL) ×100%
Statistical analysis
All quantitative data were expressed as mean ± standard deviation from at least 3 independent experiments. The statistical significance was evaluated by one-way analysis of variance (ANOVA) followed by a Dunnett’s post-hoc test using GraphPad Prism 6.0 software (Graphpad Software, Inc., San Diego, CA, USA). All P values were two-sided, and P<0.05 were considered to indicate significant differences.
Results
α-ionone promoted the proliferation of HaCaT cells via activation of the cAMP signaling pathway
To examine the biological activities of α-ionone in keratinocytes, we first investigated its effect on cell proliferation. HaCaT cells were treated with different concentrations (10, 25, 50 µM) of α-ionone for 24 and 48 hours, and cell proliferation was assessed by CCK-8 assays. The results indicated that the α-ionone significantly enhanced the proliferation of HaCaT cells in a dose-dependent manner (Figure 1A).
α-ionone has been previously demonstrated to stimulate myogenesis via activation of cAMP signaling (27). The cAMP pathway is known to be involved in the regulation of keratinocyte proliferation and migration (29,30). Thus, cAMP may also be involved in α-ionone-stimulated cell growth. To verify that the cAMP signaling pathway underlies the stimulation by α-ionone, we measured intracellular cAMP level in HaCaT cells responding to α-ionone stimulation. The results showed that α-ionone application increased intracellular cAMP level in HaCaT cells in a dose- and time-dependent manner (Figure 1B,1C), indicating that the cAMP signaling pathway was indeed activated by α-ionone. To further verify the involvement of cAMP in α-ionone-stimulated cell growth, we evaluated the effect of α-ionone on cell proliferation in the presence of cAMP inhibitor SQ22536 (100 µM). As expected, SQ22536 significantly decreased intracellular cAMP accumulation stimulated by α-ionone (Figure 1D), and the effects of α-ionone on the proliferation of HaCaT cells were completely blocked by co-application of SQ22536 (Figure 1E). These results demonstrated that α-ionone stimulated HaCaT cell proliferation via activation of cAMP signaling pathway.
α-ionone accelerates the migration of HaCaT cells via cAMP signaling pathway
We next examined the ability of α-ionone to accelerate cell migration using the scratch wound healing assay. As shown in Figure 2, when HaCaT cells were treated with increasing concentrations of α-ionone for 12 hours and 24 hours, significantly increased cell migration was observed. An α-ionone-induced increase in migration rate was first observed at 12 hours and persisted up to 24 hours post-stimulation (Figure 2A). Moreover, co-incubation of SQ22536 (100 µM) significantly mitigated α-ionone-induced migratory response (Figure 2B), implying that α-ionone-induced promotion of cell motility requires the activation of the cAMP signaling pathway.
α-ionone increases HAS2/3 expression and enhances HA production in HaCaT cells via cAMP signaling pathway
Given that epidermal-derived HA has been implicated in keratinocyte migration and proliferation, we next examined whether α-ionone is capable of enhancing HA production in HaCaT cells. It is known that HA is synthesized in keratinocytes by 3 HAS isoforms, namely, HAS1, HAS2, and HAS3. We at first examined the effects of α-ionone on the mRNA expression of HASs in HaCaT cells using qPCR. As shown in Figure 3, α-ionone significantly increased the mRNA levels of HAS2 and HAS3, but not HAS1, in HaCaT cells (Figure 3A). We further evaluated the effects of α-ionone on HA production in HaCaT cells using ELISA, and found that the HA content in the media of HaCaT cells was significantly elevated after treatment with α-ionone (Figure 3B), which coincided with the results of mRNA. To determine whether α-ionone-induced expression of HAS2 and HAS3 were mediated via the cAMP pathway, HaCaT cells were treated with α-ionone in the presence of SQ22536 (100 µM). The SQ22536 co-application significantly blocked the stimulatory effects of α-ionone on HAS2 and HAS3 mRNA expression in HaCaT cells (Figure 3C), indicating that α-ionone exerted its effect on the expression of HAS2 and HAS3 via the cAMP pathway.
α-ionone increases HBD-2 expression and production in HaCaT cells via the cAMP signaling pathway
Although initially identified for their role in fending off microbes, HBDs are also important mediators in wound healing processes and induce keratinocyte migration and proliferation (15). It is known that HBDs are produced constitutively (HBD-1) or induced in response to microbial products or proinflammatory cytokines (HBD-2) in keratinocytes (31). Here, we evaluated the effect of α-ionone on the expression of HBD-1 and HBD-2 in HaCaT cells using qPCR. As shown in Figure 4, the expression of HBD-2, but not HBD-1, was significantly upregulated in HaCaT cells after treatment with α-ionone. Corroborating this finding, the supernatant derived from α-ionone-treated HaCaT cells showed an increased level of HBD-2 compared with non-treated cells (Figure 4B). We also evaluated the effect of α-ionone on the expression of HBD-2 in the presence of SQ22536 (100 µM), and found that the enhanced gene expression of HBD-2 elicited by α-ionone was completely blocked by co-incubation of SQ22536 (Figure 4C), suggesting that α-ionone induces HBD-2 expression via cAMP signaling in HaCaT cells.
Topical application of α-ionone accelerates the recovery of a disrupted epidermal barrier after tape stripping of human skin
Our in vitro study demonstrated modulation of α-ionone on keratinocyte functions related to skin barrier repair. To extend the translational significance of these findings, we further investigated the in vivo effect of α-ionone on skin barrier recovery. Here we tested whether topical application of α-ionone-containing hydrogens were able to accelerate permeability barrier recovery in healthy volunteers after barrier disruption by tape-stripping. In this experiment, a barrier disruption was generated by removing the SC of volar forearms through repeated tape-stripping for 3 consecutive days. The α-ionone-containing hydrogens or hydrogen vehicle were then topically applied on the stripped sites once daily. The epidermal permeability barrier recovery was examined over 7 days by monitoring TEWL and SC hydration. As shown in Figure 5, a marked barrier damage due to the repeated tape-stripping (increased TEWL) was detectable on day 2. The TEWL values at all test areas had increased from ~5 g/m2/h (baseline) to ~13 g/m2/h on day 2 (Figure 5A). After once-daily α-ionone-containing hydrogen treatment, lower TEWL values and elevated SC hydration were detected in the treated sites in comparison with stripped only (untreated) area on day 7. The lowest TEWL values were seen in the α-ionone hydrogels-treated sites with a significant difference against the untreated and hydrogel vehicle-treated test area (Figure 5A). The SC hydration was highest in the 2 α-ionone hydrogels-treated sites with significant differences against the untreated and hydrogel vehicle-treated test area (Figure 5B). The 1% α-ionone hydrogels-treated sites showed the best recovery rate. The recovery rate at day 7 post-treatment increased in these sites to greater than 15% when compared to the vehicle-treated sites (Figure 5C). These results suggest that α-ionone can accelerate epidermal permeability barrier recovery and improved SC hydration.
Discussion
In the present study, we explored the regulatory effect of α-ionone on keratinocyte functions associated with skin barrier repair and reveal the promotive effects of α-ionone on cell proliferation, migration, and production of HA and HBD-2 in HaCaT cells. Meanwhile, we observed an increase in the intracellular cAMP level in HaCaT cells upon α-ionone stimulation. Using a specific cAMP inhibitor SQ22536, we demonstrated that α-ionone appears to exert its beneficial effects via a cAMP-dependent signaling pathway. We also showed that topical application of α-ionone accelerates the epidermal barrier recovery of human skin after barrier disruption.
HaCaT cells are an immortalized human keratinocyte line which exhibits all the major surface markers and functional properties comparable to isolated primary keratinocytes (32,33). Therefore, this cell line is often used as a suitable alternative model for in vitro studies of keratinocyte functions and skin biology. Here, we showed that stimulation of HaCaT cells with α-ionone leads to significantly enhanced cell proliferation and elevated motility. Considering that defects in keratinocyte proliferation and migration are closely associated with delayed wound healing and retarded barrier recovery (34), we suggest that α-ionone might enhance skin wound repair and barrier recovery through promoting keratinocyte proliferation and migration.
In addition to cell proliferation and migration, α-ionone also has the ability to activate keratinocytes to produce HA and HBD-2. As a major component of the epidermal extracellular matrix, HA is actively synthesized in keratinocytes by several HA synthases (e.g., HAS1, HAS2, and HAS3) (35,36). HA has been implicated in regulation of several key keratinocyte functions including cell proliferation and migration (20). Alterations in HA metabolism are associated with keratinocyte dysfunction, skin barrier abnormality, and impaired wound healing (19). Especially, HA appears to be an important determinant of the migratory activity in keratinocytes. Keratinocytes overexpressing HAS2 migrate faster, whereas antisense inhibition of HAS2 delays keratinocyte migration (37). Furthermore, the enhanced HA synthesis has been shown to act as an effector for migratory response of keratinocytes induced by KGF and EGF (38,39). HBDs are a group of AMPs secreted by skin epithelium. Human keratinocytes express 3 HBDs (HBD-1, HBD-2, and HBD-3) (40). These HBDs are of importance to the protective barrier of skin. In addition to their antimicrobial activity, HBDs have been reported to induce keratinocyte proliferation and migration (15,41), promote wound closure (42), and improve the functional tight-junction barrier in keratinocytes (43). Therefore, promoting endogenous HBD expression might be beneficial for the restoration of skin barrier integrity. Here, our data indicate that α-ionone increases expression of both HAS2 and HAS3 and enhances HA production in HaCaT cells. In addition, we observed that α-ionone promotes the expression of HBD-2 at both gene and protein levels. Given the essential regulatory role of HA and HBDs in keratinocyte proliferation and migration, increasing the production of HA and HBD-2 could represent a potential mechanism by which α-ionone promotes the proliferation and migration of HaCaT cells. Further study is needed to determine whether the increased production of HA and HBDs is actually responsible for enhanced proliferation and migration of HaCaT cells induced by α-ionone.
It is well known that intracellular cAMP is a major second signaling messenger for G-protein coupled receptors (GPCR) that responds to various extracellular signals, including hormones, growth factors, and neurotransmitters (44). Upon ligand binding, GPCR activates adenylate cyclase with subsequent synthesis of cAMP. Intracellular cAMP increased by extracellular stimuli mediates diverse biological effects, including cell proliferation and migration (29,30). cAMP signaling is also implicated in regulating the expression of HAS and HBD (45-51). Sufficient evidence has linked cAMP signaling to the regulation of skin homeostasis (52). Notably, cAMP can either activate or suppress keratinocyte proliferation and migration (53-57). Actually, cAMP differentially regulates cell proliferation and migration depending on the ligand used (the cAMP inducer type), levels of cAMP increased, and downstream signaling cascades (29,30). Of interest, olfactory receptors (ORs), which belong to the GPCR family, have recently been found to be functionally expressed in keratinocytes and participate in regulation of cell proliferation and migration (58). Activation of certain ORs (OR2AT4, OR2A4/7, and OR51B5) by corresponding odorant ligands (sandalore, cyclohexyl salicylate, and isononyl alcohol) induces a cAMP-dependent pathway, and enhances proliferation, migration, and regeneration of human keratinocytes (59,60). In the present study, treatment of HaCaT cells with α-ionone significantly increased the intracellular cAMP levels, indicating the activation of the cAMP signaling pathway by α-ionone. Furthermore, its stimulatory effects on cell proliferation, migration, and gene expression of HAS2/3 and HBD-2 were all abrogated by the cAMP inhibitor, indicating that the α-ionone-induced activation of the cAMP signaling pathway is required for the beneficial effects of α-ionone on HaCaT cells. Although the mechanisms of how α-ionone increases intracellular cAMP levels remain unknown, it is noteworthy that α-ionone was recently identified as an agonist for 2 ORs, namely OR51E2 and OR10A6 (61,62). As these ORs have been detected to be expressed in human keratinocytes (62), it is quite possible that one or both may participate in the α-ionone-induced increase in cAMP levels. Additional studies are needed to evaluate this possibility.
α-ionone has been widely used in the cosmetic industry as a fragrance ingredient with no reports of skin irritation or sensitization (24). However, its potential beneficial effects on skin health have been only marginally investigated so far. A previous study demonstrated that α-ionone could protect human dermal fibroblasts from UVB-induced photoaging through preventing UVB-induced decrease of collagen and HA (28). Here, we observed that α-ionone treatment led to an increase in cell proliferation and migration, as well as the production of HA and HBD-2 in HaCaT cells, all of which are beneficial to epidermal barrier recovery. Based on these observations, we predicted that topical application of α-ionone should speed up wound repair and accelerate epidermal permeability barrier recovery. Accordingly, topical α-ionone-containing hydrogel accelerated epidermal permeability barrier recovery of tape-strip-disrupted healthy human skin and improved hydration of tape-stripped SC. The exact mechanisms accounting for α-ionone-induced improvement of epidermal barrier function remain to be clarified. However, based on our in vitro data, we presume that α-ionone-induced promotion of keratinocyte functions likely accounts for the improvements in epidermal functions.
The findings of the present study also suggest possible applications of α-ionone for the management of skin conditions involving keratinocyte dysfunction, such as aged skin and chronic glucocorticoid-treated skin (63-67). Aged skin is often characterized by abnormal keratinocyte proliferation and delayed permeability barrier recovery (68,69). In particular, thinning of the epidermis in aged skin is closely associated with decreased keratinocyte proliferation. Skin aging also results in delayed wound healing, partially due to reduced keratinocyte migration (70). Many bioactive substances such as retinoids (71,72) and the active metabolites of vitamin D3 (73,74) exert their antiaging effects in skin through promotion of keratinocyte proliferation to strengthen the epidermal protective function necessary for maintaining skin homeostasis. Topical HA application of different sizes is reported to promote keratinocyte functions and overcome age-related epidermal dysfunction (19,20). In this context, applications of α-ionone might be effective for improving aged skin. Defective epidermal functions are also common in patients chronically treated with glucocorticoids (GC). Skin atrophy and barrier disturbance are well-recognized adverse effects of topical GC (63-67). Psychological stress (PS) rapidly increases endogenous GC levels, which also adversely affects the barrier homeostasis (75). Several previous studies have shown that topical GC or endogenous GC under PS exacerbates skin barrier function. GC-induced barrier function deterioration can be attributed to an inhibition of epidermal proliferation, differentiation, and HA/HBD production (76-78). PS also delays cutaneous barrier recovery after barrier disruption, and inhalation of specific odorants accelerates skin barrier recovery in mice and humans. Chronic stress-induced disruption of the skin barrier can be limited or prevented by rose essential oil inhalation (79). It has been proposed that the odorant substance directly affects the cutaneous barrier homeostatic response (80). Our data further support the notion that epidermal keratinocytes could be directly targeted by odorants, resulting in skin function regulation which may help to prevent GC-induced permeability barrier abnormality. Further studies are needed to further assess these speculations.
Conclusions
In this study, we explored the regulatory effects of α-ionone on the barrier-related functions of keratinocytes and found that α-ionone stimulation activated the cAMP signaling pathway, leading to an improvement in a variety of functions related to epidermal barrier properties, including cell proliferation, migration, and production of HA and HBD-2 in HaCaT cells. Furthermore, our in vivo study showed that topical α-ionone accelerated the epidermal barrier recovery of human skin after barrier disruption by tape stripping. These findings suggest the potential therapeutic application of α-ionone in the treatment of skin barrier dysfunction.
Acknowledgments
Funding: This study was financially supported by Shiseido China Innovation Center.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-23-1239/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-23-1239/dss
Peer Review File: Available at https://atm.amegroups.com/article/view/10.21037/atm-23-1239/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-23-1239/coif). BF and EL report personal fees from LB Cosmeceutical Technology Co., Ltd. TL and YN report personal fees from Shiseido China Innovation Center. All authors report that this study was financially supported by Shiseido China Innovation Center.
Ethics Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The human skin barrier recovery study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was reviewed and approved by the institutional review board of Fengxian Hospital Affiliated to the Southern Medical University, Shanghai, China (approval number SL2023-KY-03-01). All volunteers enrolled completed the informed consent form.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Eckhart L, Zeeuwen PLJM. The skin barrier: Epidermis vs environment. Exp Dermatol 2018;27:805-6. [Crossref] [PubMed]
- Proksch E, Brandner JM, Jensen JM. The skin: an indispensable barrier. Exp Dermatol 2008;17:1063-72. [Crossref] [PubMed]
- Baroni A, Buommino E, De Gregorio V, et al. Structure and function of the epidermis related to barrier properties. Clin Dermatol 2012;30:257-62. [Crossref] [PubMed]
- Chen Y, Li X, Gan X, et al. Fucoidan from Undaria pinnatifida Ameliorates Epidermal Barrier Disruption via Keratinocyte Differentiation and CaSR Level Regulation. Mar Drugs 2019;17:660. [Crossref] [PubMed]
- Lefèvre-Utile A, Braun C, Haftek M, et al. Five Functional Aspects of the Epidermal Barrier. Int J Mol Sci 2021;22:11676. [Crossref] [PubMed]
- Matsui T, Amagai M. Dissecting the formation, structure and barrier function of the stratum corneum. Int Immunol 2015;27:269-80. [Crossref] [PubMed]
- Simpson CL, Patel DM, Green KJ. Deconstructing the skin: cytoarchitectural determinants of epidermal morphogenesis. Nat Rev Mol Cell Biol 2011;12:565-80. [Crossref] [PubMed]
- Eyerich S, Eyerich K, Traidl-Hoffmann C, et al. Cutaneous Barriers and Skin Immunity: Differentiating A Connected Network. Trends Immunol 2018;39:315-27. [Crossref] [PubMed]
- Yang G, Seok JK, Kang HC, et al. Skin Barrier Abnormalities and Immune Dysfunction in Atopic Dermatitis. Int J Mol Sci 2020;21:2867. [Crossref] [PubMed]
- Rittié L, Fisher GJ. Natural and sun-induced aging of human skin. Cold Spring Harb Perspect Med 2015;5:a015370. [Crossref] [PubMed]
- Hänel KH, Cornelissen C, Lüscher B, et al. Cytokines and the skin barrier. Int J Mol Sci 2013;14:6720-45. [Crossref] [PubMed]
- Jeong D, Qomaladewi NP, Lee J, et al. The Role of Autophagy in Skin Fibroblasts, Keratinocytes, Melanocytes, and Epidermal Stem Cells. J Invest Dermatol 2020;140:1691-7. [Crossref] [PubMed]
- Zhang S, Duan E. Epigenetic regulations on skin wound healing: Implications from current researches . Annals of translational medicine 2015;3:227. [PubMed]
- Rice G, Rompolas P. Advances in resolving the heterogeneity and dynamics of keratinocyte differentiation. Curr Opin Cell Biol 2020;67:92-8. [Crossref] [PubMed]
- Niyonsaba F, Ushio H, Nakano N, et al. Antimicrobial peptides human beta-defensins stimulate epidermal keratinocyte migration, proliferation and production of proinflammatory cytokines and chemokines. J Invest Dermatol 2007;127:594-604. [Crossref] [PubMed]
- van Kilsdonk JWJ, Jansen PAM, van den Bogaard EH, et al. The Effects of Human Beta-Defensins on Skin Cells in vitro. Dermatology 2017;233:155-63. [Crossref] [PubMed]
- Takahashi M, Umehara Y, Yue H, et al. The Antimicrobial Peptide Human β-Defensin-3 Accelerates Wound Healing by Promoting Angiogenesis, Cell Migration, and Proliferation Through the FGFR/JAK2/STAT3 Signaling Pathway. Front Immunol 2021;12:712781. [Crossref] [PubMed]
- Niyonsaba F, Kiatsurayanon C, Ogawa H. The role of human β-defensins in allergic diseases. Clin Exp Allergy 2016;46:1522-30. [Crossref] [PubMed]
- Bourguignon LY. Matrix hyaluronan-activated CD44 signaling promotes keratinocyte activities and improves abnormal epidermal functions. Am J Pathol 2014;184:1912-9. [Crossref] [PubMed]
- Bourguignon LY, Wong G, Xia W, et al. Selective matrix (hyaluronan) interaction with CD44 and RhoGTPase signaling promotes keratinocyte functions and overcomes age-related epidermal dysfunction. J Dermatol Sci 2013;72:32-44. [Crossref] [PubMed]
- Dicker KT, Gurski LA, Pradhan-Bhatt S, et al. Hyaluronan: a simple polysaccharide with diverse biological functions. Acta Biomater 2014;10:1558-70. [Crossref] [PubMed]
- Kawano Y, Patrulea V, Sublet E, et al. Wound Healing Promotion by Hyaluronic Acid: Effect of Molecular Weight on Gene Expression and In Vivo Wound Closure. Pharmaceuticals (Basel) 2021;14:301. [Crossref] [PubMed]
- Api AM, Belsito D, Bhatia S, et al. RIFM fragrance ingredient safety assessment, α-Ionone, CAS Registry Number 127-41-3. Food Chem Toxicol 2016;97S:S1-S10. [Crossref] [PubMed]
- RIFM Expert Panel. A toxicologic and dermatologic assessment of ionones when used as fragrance ingredients. Food Chem Toxicol 2007;45:S130-67. [Crossref] [PubMed]
- Lalko J, Lapczynski A, Politano VT, et al. Fragrance material review on alpha-ionone. Food Chem Toxicol 2007;45:S235-40. [Crossref] [PubMed]
- Ge Yiqing, Tao Tong. Research Progress on Bioactivities of Food Flavor α-ionone. Science and Technology of Food Industry 2022;43:481-8.
- Tong T, Kim M, Park T. α-Ionone attenuates high-fat diet-induced skeletal muscle wasting in mice via activation of cAMP signaling. Food Funct 2019;10:1167-78. [Crossref] [PubMed]
- Tong T, Park J, Moon Y, et al. α-Ionone Protects Against UVB-Induced Photoaging in Human Dermal Fibroblasts. Molecules 2019;24:1804. [Crossref] [PubMed]
- Takahashi H, Honma M, Miyauchi Y, et al. Cyclic AMP differentially regulates cell proliferation of normal human keratinocytes through ERK activation depending on the expression pattern of B-Raf. Arch Dermatol Res 2004;296:74-82. [Crossref] [PubMed]
- Iwasaki T, Chen JD, Kim JP, et al. Dibutyryl cyclic AMP modulates keratinocyte migration without alteration of integrin expression. J Invest Dermatol 1994;102:891-7. [Crossref] [PubMed]
- Harder J, Schröder JM. Antimicrobial peptides in human skin. Chem Immunol Allergy 2005;86:22-41. [Crossref] [PubMed]
- Boukamp P, Petrussevska RT, Breitkreutz D, et al. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol 1988;106:761-71. [Crossref] [PubMed]
- Wilson VG. Growth and differentiation of HaCaT keratinocytes. Methods Mol Biol 2014;1195:33-41. [Crossref] [PubMed]
- Pastar I, Stojadinovic O, Yin NC, et al. Epithelialization in Wound Healing: A Comprehensive Review. Adv Wound Care (New Rochelle) 2014;3:445-64. [Crossref] [PubMed]
- Itano N, Kimata K. Mammalian hyaluronan synthases. IUBMB Life 2002;54:195-9. [Crossref] [PubMed]
- Papakonstantinou E, Roth M, Karakiulakis G. Hyaluronic acid: A key molecule in skin aging. Dermatoendocrinol 2012;4:253-8. [Crossref] [PubMed]
- Rilla K, Lammi MJ, Sironen R, et al. Changed lamellipodial extension, adhesion plaques and migration in epidermal keratinocytes containing constitutively expressed sense and antisense hyaluronan synthase 2 (Has2) genes. J Cell Sci 2002;115:3633-43. [Crossref] [PubMed]
- Karvinen S, Pasonen-Seppänen S, Hyttinen JM, et al. Keratinocyte growth factor stimulates migration and hyaluronan synthesis in the epidermis by activation of keratinocyte hyaluronan synthases 2 and 3. J Biol Chem 2003;278:49495-504. [Crossref] [PubMed]
- Pienimaki JP, Rilla K, Fulop C, et al. Epidermal growth factor activates hyaluronan synthase 2 in epidermal keratinocytes and increases pericellular and intracellular hyaluronan. J Biol Chem 2001;276:20428-35. [Crossref] [PubMed]
- Scott MG, Hancock RE. Cationic antimicrobial peptides and their multifunctional role in the immune system. Crit Rev Immunol 2000;20:407-31. [PubMed]
- Frye M, Bargon J, Gropp R. Expression of human beta-defensin-1 promotes differentiation of keratinocytes. J Mol Med (Berl) 2001;79:275-82. [Crossref] [PubMed]
- Hirsch T, Spielmann M, Zuhaili B, et al. Human beta-defensin-3 promotes wound healing in infected diabetic wounds. J Gene Med 2009;11:220-8. [Crossref] [PubMed]
- Kiatsurayanon C, Niyonsaba F, Smithrithee R, et al. Host defense (Antimicrobial) peptide, human β-defensin-3, improves the function of the epithelial tight-junction barrier in human keratinocytes. J Invest Dermatol 2014;134:2163-73. [Crossref] [PubMed]
- Pierce KL, Premont RT, Lefkowitz RJ. Seven-transmembrane receptors. Nat Rev Mol Cell Biol 2002;3:639-50. [Crossref] [PubMed]
- Marunaka K, Shu S, Kobayashi M, et al. Elevation of Hyaluronan Synthase by Magnesium Supplementation Mediated through the Activation of GSK3 and CREB in Human Keratinocyte-Derived HaCaT Cells. Int J Mol Sci 2021;23:71. [Crossref] [PubMed]
- Kim JE, Kim B, Kim H, et al. Retinyl retinoate induces hyaluronan production and less irritation than other retinoids. J Dermatol 2010;37:448-54. [Crossref] [PubMed]
- Kuroda Y, Higashi H. Regulation of hyaluronan production by β2 adrenergic receptor signaling. Biochem Biophys Res Commun 2021;575:50-5. [Crossref] [PubMed]
- Sussmann M, Sarbia M, Meyer-Kirchrath J, et al. Induction of hyaluronic acid synthase 2 (HAS2) in human vascular smooth muscle cells by vasodilatory prostaglandins. Circ Res 2004;94:592-600. [Crossref] [PubMed]
- Schiller M, Dennler S, Anderegg U, et al. Increased cAMP levels modulate transforming growth factor-beta/Smad-induced expression of extracellular matrix components and other key fibroblast effector functions. J Biol Chem 2010;285:409-21. [Crossref] [PubMed]
- Olmos-Ortiz A, Olivares-Huerta A, García-Quiroz J, et al. Placentas associated with female neonates from pregnancies complicated by urinary tract infections have higher cAMP content and cytokines expression than males. Am J Reprod Immunol 2021;86:e13434. [Crossref] [PubMed]
- Roth M, Pasquali C, Stolz D, et al. Broncho Vaxom (OM-85) modulates rhinovirus docking proteins on human airway epithelial cells via Erk1/2 mitogen activated protein kinase and cAMP. PLoS One 2017;12:e0188010. [Crossref] [PubMed]
- Iglesias-Bartolome R, Torres D, Marone R, et al. Inactivation of a Gα(s)-PKA tumour suppressor pathway in skin stem cells initiates basal-cell carcinogenesis. Nat Cell Biol 2015;17:793-803. [Crossref] [PubMed]
- Green H. Cyclic AMP in relation to proliferation of the epidermal cell: a new view. Cell 1978;15:801-11. [Crossref] [PubMed]
- Kapas S, Hagi-Pavli E, Brown DW, et al. Direct effects of corticotrophin on oral keratinocyte cell proliferation. Eur J Biochem 1998;256:75-9. [Crossref] [PubMed]
- Ansari KM, Rundhaug JE, Fischer SM. Multiple signaling pathways are responsible for prostaglandin E2-induced murine keratinocyte proliferation. Mol Cancer Res 2008;6:1003-16. [Crossref] [PubMed]
- Stork PJ, Schmitt JM. Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol 2002;12:258-66. [Crossref] [PubMed]
- Yamanishi K, Kishimoto S, Yasuno H. Cyclic AMP as a negative regulator of DNA synthesis in FRSK cells, a fetal rat epidermal cell line. J Dermatol 1989;16:2-6. [Crossref] [PubMed]
- Geng R, Wang Y, Fang J, et al. Ectopic odorant receptors responding to flavor compounds in skin health and disease: Current insights and future perspectives. Crit Rev Food Sci Nutr 2022; Epub ahead of print. [Crossref] [PubMed]
- Busse D, Kudella P, Grüning NM, et al. A synthetic sandalwood odorant induces wound-healing processes in human keratinocytes via the olfactory receptor OR2AT4. J Invest Dermatol 2014;134:2823-32. [Crossref] [PubMed]
- Tsai T, Veitinger S, Peek I, et al. Two olfactory receptors-OR2A4/7 and OR51B5-differentially affect epidermal proliferation and differentiation. Exp Dermatol 2017;26:58-65. [Crossref] [PubMed]
- Sanz G, Leray I, Grébert D, et al. Structurally related odorant ligands of the olfactory receptor OR51E2 differentially promote metastasis emergence and tumor growth. Oncotarget 2017;8:4330-41. [Crossref] [PubMed]
- Duroux R, Mandeau A, Guiraudie-Capraz G, et al. A Rose Extract Protects the Skin against Stress Mediators: A Potential Role of Olfactory Receptors. Molecules 2020;25:4743. [Crossref] [PubMed]
- Schoepe S, Schäcke H, May E, et al. Glucocorticoid therapy-induced skin atrophy. Exp Dermatol 2006;15:406-20. [Crossref] [PubMed]
- Hengge UR, Ruzicka T, Schwartz RA, et al. Adverse effects of topical glucocorticosteroids. J Am Acad Dermatol 2006;54:1-15; quiz 16-8. [Crossref] [PubMed]
- Cain DW, Cidlowski JA. Specificity and sensitivity of glucocorticoid signaling in health and disease. Best Pract Res Clin Endocrinol Metab 2015;29:545-56. [Crossref] [PubMed]
- Niculet E, Bobeica C, Tatu AL. Glucocorticoid-Induced Skin Atrophy: The Old and the New. Clin Cosmet Investig Dermatol 2020;13:1041-50. [Crossref] [PubMed]
- Bruner CR, Feldman SR, Ventrapragada M, et al. A systematic review of adverse effects associated with topical treatments for psoriasis. Dermatol Online J 2003;9:2. [Crossref] [PubMed]
- Rinnerthaler M, Duschl J, Steinbacher P, et al. Age-related changes in the composition of the cornified envelope in human skin. Exp Dermatol 2013;22:329-35. [Crossref] [PubMed]
- Rochette L, Mazini L, Meloux A, et al. Anti-Aging Effects of GDF11 on Skin. Int J Mol Sci 2020;21:2598. [Crossref] [PubMed]
- Blair MJ, Jones JD, Woessner AE, et al. Skin Structure-Function Relationships and the Wound Healing Response to Intrinsic Aging. Adv Wound Care (New Rochelle) 2020;9:127-43. [Crossref] [PubMed]
- Lesnik RH, Mezick JA, Capetola R, et al. Topical all-trans-retinoic acid prevents corticosteroid-induced skin atrophy without abrogating the anti-inflammatory effect. J Am Acad Dermatol 1989;21:186-90. [Crossref] [PubMed]
- McMichael AJ, Griffiths CE, Talwar HS, et al. Concurrent application of tretinoin (retinoic acid) partially protects against corticosteroid-induced epidermal atrophy. Br J Dermatol 1996;135:60-4. [Crossref] [PubMed]
- Reichrath J, Zouboulis CC, Vogt T, et al. Targeting the vitamin D endocrine system (VDES) for the management of inflammatory and malignant skin diseases: An historical view and outlook. Rev Endocr Metab Disord 2016;17:405-17. [Crossref] [PubMed]
- Kin KC, Hill D, Feldman SR. Calcipotriene and betamethasone dipropionate for the topical treatment of plaque psoriasis. Expert Rev Clin Pharmacol 2016;9:789-97. [Crossref] [PubMed]
- Pérez P. Glucocorticoid receptors, epidermal homeostasis and hair follicle differentiation. Dermatoendocrinol 2011;3:166-74. [Crossref] [PubMed]
- Tiganescu A, Tahrani AA, Morgan SA, et al. 11β-Hydroxysteroid dehydrogenase blockade prevents age-induced skin structure and function defects. J Clin Invest 2013;123:3051-60. [Crossref] [PubMed]
- Gebhardt C, Averbeck M, Diedenhofen N, et al. Dermal hyaluronan is rapidly reduced by topical treatment with glucocorticoids. J Invest Dermatol 2010;130:141-9. [Crossref] [PubMed]
- Jensen JM, Ahrens K, Meingassner J, et al. Differential suppression of epidermal antimicrobial protein expression in atopic dermatitis and in EFAD mice by pimecrolimus compared to corticosteroids. Exp Dermatol 2011;20:783-8. [Crossref] [PubMed]
- Fukada M, Kano E, Miyoshi M, et al. Effect of "rose essential oil" inhalation on stress-induced skin-barrier disruption in rats and humans. Chem Senses 2012;37:347-56. [Crossref] [PubMed]
- Denda M, Tsuchiya T, Shoji K, et al. Odorant inhalation affects skin barrier homeostasis in mice and humans. Br J Dermatol 2000;142:1007-10. [Crossref] [PubMed]
(English Language Editor: J. Jones)

