Early onset critically ill infants with Schaaf-Yang syndrome: a retrospective study from the China neonatal genomes project and literature review

Introduction

Genetic diseases frequently occur in neonatal intensive care units and often progress extremely rapidly, not allowing for timely diagnosis and treatment, leading to morbidity and even mortality (1,2). Most genetic diseases may already manifest at neonatal age, but the diagnosis can be complicated by variable and nonspecific phenotypes, especially in critical conditions (3-5). Moreover, some genetic conditions may be silent or only partially expressed and not easily recognizable during the neonatal age. One example is imprinting disorders, a group of rare diseases caused by common alterations affecting imprinted genes or chromosomal regions (6). The underlying molecular changes include four types: copy number variations of the imprinted region, uniparental disomy, aberrant methylation marks (epimutations), and point mutations in imprinted genes (6-8). Twelve imprinting disorders have been recognized based on different clinical findings and/or the association of specific imprinting sites with molecular interference (9).

Schaaf-Yang syndrome (SYS) (OMIM 615547) is a recently identified imprinting disorder characterized by a broad range of symptoms, including prenatal polyhydramnios, fetal akinesia, neonatal hypotonia, respiratory distress, arthrogryposis, moderate-to-severe development delay/intellectual disability (DD/ID) and autism spectrum disorder (10,11). It is caused by heterozygous truncating mutations of MAGEL2, a paternally-expressed gene located within the Prader-Willi Syndrome critical region 15q11-q13 (12,13). Approximately 50% of patients inherit a MAGEL2 pathogenic variant from a clinically unaffected father, and others are de novo. Notably, some of the specific variants are life-threatening, and the patient may die in the neonatal period.

In 2013, when SYS was first described in four individuals (14), it was originally named Prader-Willi-like syndrome, considering that MAGEL2 was also a candidate gene of Prader-Willi syndrome (OMIM176270) (15-17). Later, as emerging cases were reported, it was suggested as an entirely new disease, renamed as SYS (18). Unlike classic Mendelian genetic disorders, DNA methylation of the maternal allele of MAGEL2 results in monoallelic expression from the paternally inherited copy (19). In other words, pathogenic phenotypes occur only if the active paternal allele is affected while that on the maternal is not.

Up to now, more than 100 SYS patients have been reported by papers worldwide. As the disease was poorly understood, a proportion of patients were misdiagnosed or missed leading to an underestimate of the actual number of patients with SYS. A deeper understanding of SYS’s clinical consequences and molecular basis significantly impacts diagnostics, focused medical care, and targeted counseling for the affected family.

The objectives of this study were to analyze clinical features and genetic findings of Chinese SYS patients. Furthermore, we investigated the correlation between clinical features and genotype in the SYS population worldwide. We present this article in accordance with the STREGA reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4396/rc).

Methods

Patients and setting

Individuals with MAGEL2 pathogenic variants were enrolled based on the genotype from the China neonatal genomes project (CNGP) (NCT03931707) cohort. Neonates from the NICU or the neonatology ward of the maternity hospital with congenital anomalies and suspected genetic disease were referred to the Clinical Genetics Laboratory of Children’s Hospital of Fudan University for a genetic test and were enrolled in CNGP (20). The test period was from August 2016 to August 2021. Patients’ clinical manifestations were obtained from electronic medical records and telephone follow-ups. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013) and was approved by the ethics committee of the Children’s Hospital, Fudan University (No. 2021-45). Individual consent for this retrospective analysis was waived.

Variant analysis using clinical exome sequencing (CES)/exome sequencing (ES)

Genomic DNA was extracted from whole blood using the QIAamp DNA Blood Mini Kit (QIAGEN, Germany) according to the manufacturer’s protocol. DNA fragments were enriched for CES using the Agilent ClearSeq Inherited Disease panel kit (covering 2,742 genes, test in #2, #3, #5, #6, #7, #8, #9, #11, #12) or proband ES using the Agilent SureSelect XT Human All Exon 50 Mb kit (tested in #1, #4, #10). For details on the sequencing and analysis, please see the published paper by Wang et al. and Yang et al. (21,22). The test method was decided by the physicians’ and parents’ choices based on the test price and year.

Raw data were mapped to the human reference genome (GRCh37/hg19). Variants were annotated by ANNOVAR and VEP software, with a minor allele frequency of less than 3% according to either the 1,000 Genomes Project or the Exome Aggregation Consortium (ExAC) and in-house database (23). The pathogenicity of the candidate variant was analyzed according to the standards and guidelines recommended by the American College of Medical Genetics and Genomics (ACMG) (24) and also described in our previous paper (25).

Methylations-sensitive digestion of MAGEL2 followed by Sanger sequencing

The DNA sample was treated with methylation-sensitive restriction endonucleases digestion prior to Sanger sequencing (14). There are four cleavage sites CCGG around the mutation locus (c.1912C>T and c.1996dupC) for endonucleases HpaII (New England Biosystems). HpaII could digest only the unmethylated paternal allele of MAGEL2, while the methylated maternal allele could not. This way, the mutated allele can be determined.

Then, DNA fragments were amplified by long-range PCR with primers LR_magel2_F (GAGAATTCCACCATCGCCACTAACC) and LR_magel2_R (CAGTCCCTGCAACTTCCCACTTTCT), which were provided in the previous study (14). Nested PCR amplified specific mutation loci. The following pairs of DNA primers, which could amplify the 1260bp region near the mutation site (c.1912C>T and c.1996dupC), were used for nested PCR: MAGEL2-1260-F: GCACTGCCCTTCCATCATCT; MAGEL2-1260-R: GAGACACTTGCGACCTCAGACA—further analyzed by Sanger sequencing using an automated sequencer (3500XL Genetic Analyzer, Applied Biosystems, Waltham, MA, USA). Sequence analysis was performed using Mutation Surveyor (Soft Genetics^®, State College, PA, USA).

Statistical analysis

Descriptive statistics were used to illustrate the number of patients enrolled, the age at test (the median). The other variables described in the methodology were presented as frequencies and percentages.

Results

General characteristics of patients

Six females and six males, a total of twelve patients, received genetic diagnoses of SYS in the 42257 CNGP cohort. The test age ranged from 1 day to 4 months (median: 10 days). Nine individuals presented symptoms during the neonatal period; the other three patients were 39-day-old, 2-month-old and 4-month-old, respectively. Three babies (#8, #10, #11) were born prematurely and the other nine were in full term. Four families of #1, #4, #9, and #10 had histories of abnormal pregnancy. Four patients (#1, #4, #5, #7) died.

Genetic findings

A genetic diagnosis of SYS was identified in 12 unrelated infants in our CNGP cohort. Of these, 6 were previously reported mutations, and 6 were novel pathogenic variations in the MAGEL2 gene. The novel variants of MAGEL2 (NM_019066.5) include c.3583delA (p. Met1195CysfsTer4), c.1015C>T (p. Gln339Ter), c.648delG (p. Thr217HisfsTer22), c.2847_2883del37 (p. Ser950AlafsTer6), c.2646delC (p. Gly883AlafsTer21), and c.1104G>A (p. Trp368Ter), were identified in patient #7, #8, #9, #10, #11, and #12 respectively (Figures 1,2). These variants have not been reported in the ExAC, 1000 genome databases and our in-house databases. All variants were classified as pathogenic according to the criteria of ACMG. Two previously described variants: c.1912C>T (p. Gln638Ter) and c.1996dupC (p. Gln666ProfsTer47) were detected in #1, #2, #3 and #4, #5, and #6, respectively. All these variants were truncated, including 7 frameshifts and 5 stop-gains. Four variants were confirmed paternally inherited (#1, #2, #4, and #10) and three were de novo (#3, #5, and #6). According to recent genome annotation (UniProt Q9UJ55), nine variants were located in the proline-rich region, two in USP7 binding site domain (U7BS), and one (Met1195CysfsTer4) was in MAGE homolog domain (MHD) (Figure 1).

Figure 1 The structure of MAGEL2 protein and the distribution of the pathogenic variants. MAGEL2 protein contains a proline-rich region (from aa 1 to 819), USP7 binding site (U7BS, from aa 820 to 1034), and MAGE homolog domain (MHD, from residues 1027 to 1195). Region aa 1027 to 1034 represents overlap of domain U7BS and MHD. The pathogenic mutations in MAGEL2 are depicted by their positions. Above the box are frameshift mutations, while below the box are termination mutations. The red dots indicate that more than one person has the mutation at the site. The larger, the more cases, and the digit in the dots means case number. The red squares represent the variants in our patients.

Figure 2 Pedigree and genotypes of MAGEL2 variations analyzed by Sanger sequencing of patients. Sanger results of the variant are shown in the right of each pedigree. Circles are females, squares are males, triangles are fetuses. Empty symbols for nonaffected individuals, filled in black for affected individuals. Crossed symbols for deceased individuals, arrow points to the proband. Ref, reference; F, female; M, male; P, patient.

Clinical manifestation

Major complaint

Respiratory problems were the main reasons for hospitalization in 91.7% (11/12) of our cases. Expressly, five patients were admitted to the hospital due to neonatal anoxia, two were respiratory distress and three were neonatal pneumonia. The other two patients, #7 was for unexplained newborn moaning and #12 was for recurrent feeding problems. All babies displayed feeding difficulties and a poor suck postnatally. Neonatal dystonia was present in 11 of the cases, and two patients (#2 and #3) showed hypertonia. Joint contractures, a relatively specific manifestation of this disorder, appeared in 58.3% (7/12) cases. In addition, brain MRI in 9/12 of patients was abnormal. The anterior horn of the left lateral ventricle is slightly wider than the contralateral and the T1W1 stripe hyper signal was present in the occipital region in #1. Bilateral ventricular hypodensity was observed in #4. A few lesions near the anterior and posterior horns of bilateral ventricles as well as full lateral ventricles (especially the left one), were observed in #5. B-ultrasound of #6 suggested lateral ventricle widening at 36 gestational weeks. And #9 showed a symmetrically reduced density of white matter in bilateral frontal and parietal lobes. In addition, three patients displayed unusual electroencephalograms and seizures. Anemia and hypoglycemia occurred in two patients (#5, #8), and hyperbilirubinemia appeared in four patients (#1, #6, #9, #11). The clinical features and genotypes of the patients with MAGEL2 mutations in our study are summarized in Table 1.

Physical characteristics

Limb deformities, including clubfoot, small hand/feet and brachydactylia, were present in 4 patients (#1, #2, #4, #10). Craniofacial deformities were observed in 6 patients (#1, #2, #3, #4, #10, #12), including micrognathia, frontal bossing and almond eyes. Genitourinary abnormalities were found in 6 patients: cryptorchidism in #3 and #10, bilateral hydrocele in #7, vulva pigmentation in #1, #4 and #5. Patient 10 had congenital abnormalities of the urinary system; the left renal pelvis was slightly dissected and the left renal collecting system was dissected by 3.7 mm. In addition, congenital laryngeal cartilage dysplasia was observed in #1 and #6. Patient 8, who was indicated fetal intestinal dilatation with the widest 29 mm by prenatal B-ultrasound, got a diagnosis of congenital duodenal atresia and intestinal malrotation, which required early surgical intervention. A congenital palpebral fissure appeared in both eyes in #6 and the diameter of congenital microcornea was 8 mm. When it comes to cardiovascular system, small atrial septal defect was observed in 10/12 patients. The minimal lesions in 6 patients were closed spontaneously during follow-up (except for the fatal cases).

Hotspot and fatal variants

Unrelated cases #1, #2 and #3 bore the identical recurrent heterozygous stop gain variant c.1912C>T (p. Gln638Ter). These patients shared the majority of manifestations, such as anoxia, persistent respiratory distress and poor response soon after birth. Patients #4, #5 and #6 harbored identical pathogenic mutation of c.1996dupC (p. Gln666ProfsTer47), as well; they presented with very similar clinical phenotypes, including congenital malformations and complicated conditions, specifically neonatal hypotonia, poor spontaneous respiration, contractures and pneumonia. These six patients received respiratory and nutritional support soon after birth. Patients # 1, #4 and #5 died early in life due to respiratory failure. In the follow-up, other surviving patients were observed to have varying degrees of DD/ID.

Literature review and genotype-phenotype correlation analysis

Up to now, more than 100 individuals have been reported globally. We summarized the clinical and genetic features of 134 patients with reported SYS, including ours. The variants types and detailed information were unavailable in thirty-five patients in McCarthy’s study (12) and not included in our study.

The minimum age of onset was just one day, while the maximum was 36 years. There were no significant racial/ethnic or sex differences. Chinese patients accounted for 17.9% (24/134). In total 93.3% of patients (112/120) presented with neonatal hypotonia, 88.8% (119/134) with joint contractures, 82.7% (67/81) with facial dysmorphism, 73.9% (70/95) with respiratory dysfunction and 76.0% (38/50) with autism spectrum disorder (Table S1). Besides, 26 of 49 (53.1%) patients showed abnormal brain MRI including dysplastic or thin corpus callosum, pituitary gland appeared hypoplastic, ventriculomegaly, atrophy of cerebral white matter, generalized brain atrophy, decreased myelination, hypothalamic hypoplasia and hypoplastic vermis. Seizures occurred in 35.6% (31/87) of all individuals.

Among the 134 patients, truncating mutations were detected in 132 individuals. The remaining two individuals carried partial deletion/inversion and missense variants, respectively. In addition, 42.5% (57/134) cases harbor variants in the c.1996 site, including 50 cases with c.1996dupC, 6 cases with c.1996delC, and 1 case with c.1996_1997dupCA. The most common variant, c.1996dupC, counts for 37.3% (50/134). Furthermore, ten patients (7.5%) harbored c.1912C>T (p. Gln638Ter), four patients (3.0%) carried c.1762C>T (p. Gln588Ter), and two patients (1.5%) bored c.2179_2180delGA (p. Asp727ProTer6). Three frameshift variants (c.1800delT, c.1801_1802delCC, c.1802delC) were identified in three patients (2.3%) that lead to a truncated amino acid in Pro601GlnfsTer101, Pro601AsnfsTer111 and Pro601GlnfsTer101, respectively. Other isolated variants are scattered on the gene (Figure 1).

So far, 23 cases diagnosed with SYS have been reported deceased (26-32). The genotype and clinical features of these cases are summarized in Table 2. The median age of death was 24 gestational weeks in fetuses and one-month-old in infants. Notably, 78% (18/23) of them carried the variant in the c.1996 site, including twelve c.1996dupC and six c.1996delC. The other five variants were c.1628delC, c.1850G>A, c.1912C>T, c.2118delT and c.3583delA. Six aborted fetuses shared identical variants and similar phenotypic expressions with fetal akinesia, severe arthrogryposis and multiple joint contractures, overlapping fingers, club feet, and dysmorphic facial features, including low-set ears and micrognathia. Respiratory failure was the first cause of death in live-born patients (58.8%, 10/17), especially during the neonatal period. The girl who carried c.1628delC died five days after admission due to cardiovascular failure and also manifested dyspnea. The patient with c.1850G>A died of sleep apnea caused by her extreme obesity. A 2-month-old boy carrying c.1996dupC died due to dyspnea. What calls for special attention is that those truncating mutations (c.3583delA excepted) are located in the middle point of the whole gene.

Discussion

In this study, 12 infants with heterozygous truncating mutations of MAGEL2 were identified using next-generation sequencing in 42,257 individuals CNGP cohort. Our patients were characterized by early onset and were seriously ill. They attained early diagnosis with a median test age of just 10 days. The 12 critically ill babies presented respiratory distress, dystonia, joint contractures, feeding difficulty, and multiple congenital defects in the neonatal period, which is the most vulnerable time in a child’s life. However, most individuals reported previously showed symptoms in infancy not receiving a definite diagnosis until childhood and adolescence (33).

MAGEL2 is highly expressed in the brain especially in the hypothalamus, and is essential in neuropeptides, neuronal signaling transduction and neuronal axonal growth (34-38). SYS was therefore defined as a neurodevelopmental disease (18). In fact, SYS is a multi-system involved disorder with variable clinical manifestations. We found that the typical symptoms of SYS include neonatal hypotonia, joint contractures, facial dysmorphism, and respiratory dysfunction, consistent with McCarthy’s cohort (12), In the natural progression of the disease, all patients showed varying degrees of developmental delay and over 75% displayed with an autism spectrum disorder.

Newborn hypotonia is a hallmark trait in over 90% of SYS patients, which is related to multi-system phenotypes such as joint contracture, respiratory impairment, feeding abnormalities and reduced movement. The underlying causes involve the central nervous systems and peripheral nervous systems (39). MAGEL2 is expressed in cells of mesodermal origin that contribute to the formation of fat, muscle, and bone (40). It is found that Magel2-null mice had increased fat mass, less lean mass, and reduced bone mass which could principally be caused by differentiation defects (40,41). In addition, the expression of atrophy gene Murf1, which is important for regulation of ubiquitin-mediated protein degradation in skeletal muscle, was elevated in Magel2-null mice and may result in imbalance of protein synthesis and degradation (40,42).

Respiratory dysfunction is another concern that is highly disruptive to 78% of SYS patients’ daily life and represents the most common fatal cause in SYS infants. Recurrent respiratory distress remains a problem during infancy, with frequent exacerbations during common viral infections. Over 90% of babies in our cohort required oxygen supplementation and non-invasive or invasive respiratory supports, which is consistent with McCarthy’s findings. In addition, patients with c.1996dupC had a higher rate of requiring intubation or mechanical ventilation, almost twice as high as the other variants (12). Until now, the underlying pathology of dyspnea remains elusive, but it can be determined that it is multifactorial, involving both central and peripheral mechanisms. For one thing, MAGEL2 is highly expressed in the hypothalamus; truncating mutations lead to hypothalamus dysfunction and an inability to adjust the respiratory rate to compensate for the increase in carbon dioxide and a decrease in oxygen levels (43); for another, hypotonia leads to weak respiratory musculature and depressed respiratory response.

Exploration of individuals’ phenotypic features and mutation positions revealed further genotype-phenotype association. Hotspot mutation and the most serious variant are associated with the c.1996 site. We found that the c.1996 mutation occurred in nearly 50% of patients and in 78% of deaths. Specifically, c.1996dupC is the most common and severe mutation in SYS patients with higher prevalence of respiratory distress, joint contractures, and more severe ID/DD than other variants (exclude c.1996delC) (12). While c.1996delC was proven to be embryonically lethal, all six fetuses were aborted in the middle of pregnancy due to hypokinesia and severe arthrogryposis (28). MAGEL2 gene is GC-rich, especially the c.1990_c.1996 consequence containing seven consecutive cytosines. Why MAGEL2 mutations occur most often in the c.1996 site and why c.1996dupC and c.1996delC mutations lead to such markedly different phenotypes need to be studied.

Another finding was that critical illness and death tended to occur in individuals with mid-truncated mutations because hotspot variants and fatal mutations are concentrated in the midpoint of protein. McCarthy et al. indicated that the severity of SYS depended on the specific location of the truncating mutation (12). Since MAGEL2 is a single-exon gene, mutations that cause premature stop codons are not predicted to lead to nonsense-mediated mRNA decay (11,44). Frameshift mutations of the c.1996 site encode a mid-truncated MAGEL2 protein that is no longer associated with the C-terminal and may therefore impair the dynamics of the ribosome for liquid-liquid phase separation, leading to pathological aggregation of the MAGEL2 protein in RNA-rich particles. However, c.3583 cite is an exception which is located near the end of C-term, and even weirder is that our patient with c.3583delA did not appear in respiratory distress; instead, he presented hemophagocytic syndrome. These findings suggest that truncated mutation at specific loci appears to be incompatible with life.

Our study has several limitations. First, it was retrospective and lacked a control group. Clinical data were collected principally through chart review, which may have led to under- or overestimates of acute changes in management. Second, our patients were too young to assess their language development, behavioral performance and neurocognition.

Conclusions

Our study identified twelve critically ill Chinese SYS infants with six novel deleterious truncating variants in MAGEL2, expanding SYS’s genotype and phenotype spectrum. The results demonstrated that respiratory dysfunction and dystonia were typical characteristics among Chinese SYS patients which should attract physicians’ attention. The early identification of such a disorder is critical as it allows early intervention with specific care and treatment. More importantly, improving genetic diagnosis can provide genetic counseling and prenatal diagnosis for families.

Acknowledgments

We are very grateful to the patient’s families and the clinicians and our genetic laboratory teams who contributed to this study.

Funding: This work was supported by the cohort study of rare neonatal diseases found by the Children’s Hospital of Fudan University (No. 2020ZBDL14, to Dr. Wang), Shen Kang Hospital Development Center Clinical Science and Technology Innovation Project of Shanghai (No. SHDC12017110, to Prof. Zhou; No. SHDC12017607, to Dr. Wu).

Footnote

Reporting Checklist: The authors have completed the STREGA reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4396/rc

Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-4396/dss

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-4396/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). This study was approved by the ethics committee of the Children’s Hospital, Fudan University (No. 2021-45) and individual consent for this retrospective analysis was waived.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Meng L, Pammi M, Saronwala A, et al. Use of Exome Sequencing for Infants in Intensive Care Units: Ascertainment of Severe Single-Gene Disorders and Effect on Medical Management. JAMA Pediatr 2017;171:e173438. [Crossref] [PubMed]
2. French CE, Delon I, Dolling H, et al. Whole genome sequencing reveals that genetic conditions are frequent in intensively ill children. Intensive Care Med 2019;45:627-36. [Crossref] [PubMed]
3. Clark MM, Hildreth A, Batalov S, et al. Diagnosis of genetic diseases in seriously ill children by rapid whole-genome sequencing and automated phenotyping and interpretation. Sci Transl Med 2019;11:eaat6177. [Crossref] [PubMed]
4. Wu B, Kang W, Wang Y, et al. Application of Full-Spectrum Rapid Clinical Genome Sequencing Improves Diagnostic Rate and Clinical Outcomes in Critically Ill Infants in the China Neonatal Genomes Project. Crit Care Med 2021;49:1674-83. [Crossref] [PubMed]
5. Raymond FL. Clinical Genomics in Critically Ill Infants and Children. JAMA 2020;323:2480-2. [Crossref] [PubMed]
6. Peters J. The role of genomic imprinting in biology and disease: an expanding view. Nat Rev Genet 2014;15:517-30. [Crossref] [PubMed]
7. Chao Y, Qin Y, Zou X, et al. Promising therapeutic aspects in human genetic imprinting disorders. Clin Epigenetics 2022;14:146. [Crossref] [PubMed]
8. Tucci V, Isles AR, Kelsey G, et al. Genomic Imprinting and Physiological Processes in Mammals. Cell 2019;176:952-65. [Crossref] [PubMed]
9. Soellner L, Begemann M, Mackay DJ, et al. Recent Advances in Imprinting Disorders. Clin Genet 2017;91:3-13. [Crossref] [PubMed]
10. Boccaccio I, Glatt-Deeley H, Watrin F, et al. The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region. Hum Mol Genet 1999;8:2497-505. [Crossref] [PubMed]
11. Lee S, Kozlov S, Hernandez L, et al. Expression and imprinting of MAGEL2 suggest a role in Prader-willi syndrome and the homologous murine imprinting phenotype. Hum Mol Genet 2000;9:1813-9. [Crossref] [PubMed]
12. McCarthy J, Lupo PJ, Kovar E, et al. Schaaf-Yang syndrome overview: Report of 78 individuals. Am J Med Genet A 2018;176:2564-74. [Crossref] [PubMed]
13. Mishra A, Prabha PK, Singla R, et al. Epigenetic Interface of Autism Spectrum Disorders (ASDs): Implications of Chromosome 15q11-q13 Segment. ACS Chem Neurosci 2022;13:1684-96. [Crossref] [PubMed]
14. Schaaf CP, Gonzalez-Garay ML, Xia F, et al. Truncating mutations of MAGEL2 cause Prader-Willi phenotypes and autism. Nat Genet 2013;45:1405-8. [Crossref] [PubMed]
15. Cheon CK. Genetics of Prader-Willi syndrome and Prader-Will-Like syndrome. Ann Pediatr Endocrinol Metab 2016;21:126-35. [Crossref] [PubMed]
16. Mercer RE, Wevrick R. Loss of magel2, a candidate gene for features of Prader-Willi syndrome, impairs reproductive function in mice. PLoS One 2009;4:e4291. [Crossref] [PubMed]
17. Devos J, Weselake SV, Wevrick R. Magel2, a Prader-Willi syndrome candidate gene, modulates the activities of circadian rhythm proteins in cultured cells. J Circadian Rhythms 2011;9:12. [Crossref] [PubMed]
18. Fountain MD, Schaaf CP. Prader-Willi Syndrome and Schaaf-Yang Syndrome: Neurodevelopmental Diseases Intersecting at the MAGEL2 Gene. Diseases 2016;4:2. [Crossref] [PubMed]
19. Lalande M. Parental imprinting and human disease. Annu Rev Genet 1996;30:173-95. [Crossref] [PubMed]
20. Xiao F, Yan K, Wang H, et al. Protocol of the China Neonatal Genomes Project: an observational study about genetic testing on 100,000 neonates. Pediatr Med 2021;4:28. [Crossref]
21. Wang H, Xiao F, Dong X, et al. Diagnostic and clinical utility of next-generation sequencing in children born with multiple congenital anomalies in the China neonatal genomes project. Hum Mutat 2021;42:434-44. [Crossref] [PubMed]
22. Yang L, Kong Y, Dong X, et al. Clinical and genetic spectrum of a large cohort of children with epilepsy in China. Genet Med 2019;21:564-71. [Crossref] [PubMed]
23. McLaren W, Pritchard B, Rios D, et al. Deriving the consequences of genomic variants with the Ensembl API and SNP Effect Predictor. Bioinformatics 2010;26:2069-70. [Crossref] [PubMed]
24. Riggs ER, Andersen EF, Cherry AM, et al. Correction: Technical standards for the interpretation and reporting of constitutional copy-number variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics (ACMG) and the Clinical Genome Resource (ClinGen). Genet Med 2021;23:2230. [Crossref] [PubMed]
25. Dong X, Liu B, Yang L, et al. Clinical exome sequencing as the first-tier test for diagnosing developmental disorders covering both CNV and SNV: a Chinese cohort. J Med Genet 2020;57:558-66. [Crossref] [PubMed]
26. Kleinendorst L, Pi Castán G, Caro-Llopis A, et al. The role of obesity in the fatal outcome of Schaaf-Yang syndrome: Early onset morbid obesity in a patient with a MAGEL2 mutation. Am J Med Genet A 2018;176:2456-9. [Crossref] [PubMed]
27. Tong W, Wang Y, Lu Y, et al. Whole-exome Sequencing Helps the Diagnosis and Treatment in Children with Neurodevelopmental Delay Accompanied Unexplained Dyspnea. Sci Rep 2018;8:5214. [Crossref] [PubMed]
28. Mejlachowicz D, Nolent F, Maluenda J, et al. Truncating Mutations of MAGEL2, a Gene within the Prader-Willi Locus, Are Responsible for Severe Arthrogryposis. Am J Hum Genet 2015;97:616-20. [Crossref] [PubMed]
29. Fountain MD, Aten E, Cho MT, et al. The phenotypic spectrum of Schaaf-Yang syndrome: 18 new affected individuals from 14 families. Genet Med 2017;19:45-52. [Crossref] [PubMed]
30. Chen X, Ma X, Zou C. Phenotypic spectrum and genetic analysis in the fatal cases of Schaaf-Yang syndrome: Two case reports and literature review. Medicine (Baltimore) 2020;99:e20574. [Crossref] [PubMed]
31. Guo W, Nie Y, Yan Z, et al. Genetic testing and PGD for unexplained recurrent fetal malformations with MAGEL2 gene mutation. Sci China Life Sci 2019;62:886-94. [Crossref] [PubMed]
32. Xiao B, Ji X, Wei W, et al. A Recurrent Variant in MAGEL2 in Five Siblings with Severe Respiratory Disturbance after Birth. Mol Syndromol 2020;10:286-90. [Crossref] [PubMed]
33. Marbach F, Elgizouli M, Rech M, et al. The adult phenotype of Schaaf-Yang syndrome. Orphanet J Rare Dis 2020;15:294. [Crossref] [PubMed]
34. Chen H, Victor AK, Klein J, et al. Loss of MAGEL2 in Prader-Willi syndrome leads to decreased secretory granule and neuropeptide production. JCI Insight 2020;5:e138576. [Crossref] [PubMed]
35. Ates T, Oncul M, Dilsiz P, et al. Inactivation of Magel2 suppresses oxytocin neurons through synaptic excitation-inhibition imbalance. Neurobiol Dis 2019;121:58-64. [Crossref] [PubMed]
36. Tacer KF, Potts PR. Cellular and disease functions of the Prader-Willi Syndrome gene MAGEL2. Biochem J 2017;474:2177-90. [Crossref] [PubMed]
37. Mercer RE, Michaelson SD, Chee MJ, et al. Magel2 is required for leptin-mediated depolarization of POMC neurons in the hypothalamic arcuate nucleus in mice. PLoS Genet 2013;9:e1003207. [Crossref] [PubMed]
38. Lee S, Walker CL, Karten B, et al. Essential role for the Prader-Willi syndrome protein necdin in axonal outgrowth. Hum Mol Genet 2005;14:627-37. [Crossref] [PubMed]
39. Morton SU, Christodoulou J, Costain G, et al. Multicenter Consensus Approach to Evaluation of Neonatal Hypotonia in the Genomic Era: A Review. JAMA Neurol 2022;79:405-13. [Crossref] [PubMed]
40. Kamaludin AA, Smolarchuk C, Bischof JM, et al. Muscle dysfunction caused by loss of Magel2 in a mouse model of Prader-Willi and Schaaf-Yang syndromes. Hum Mol Genet 2016;25:3798-809. [Crossref] [PubMed]
41. Baraghithy S, Smoum R, Drori A, et al. Magel2 Modulates Bone Remodeling and Mass in Prader-Willi Syndrome by Affecting Oleoyl Serine Levels and Activity. J Bone Miner Res 2019;34:93-105. [Crossref] [PubMed]
42. Peris-Moreno D, Taillandier D, Polge C. MuRF1/TRIM63, Master Regulator of Muscle Mass. Int J Mol Sci 2020;21:6663. [Crossref] [PubMed]
43. Tennese AA, Wevrick R. Impaired hypothalamic regulation of endocrine function and delayed counterregulatory response to hypoglycemia in Magel2-null mice. Endocrinology 2011;152:967-78. [Crossref] [PubMed]
44. Hoek TA, Khuperkar D, Lindeboom RGH, et al. Single-Molecule Imaging Uncovers Rules Governing Nonsense-Mediated mRNA Decay. Mol Cell 2019;75:324-339.e11. [Crossref] [PubMed]