A novel variant in fibrillin-1 is responsible for early-onset familial thoracic aortic aneurysms in Marfan patients
Introduction
Marfan syndrome (MFS) is a connective tissue disorder with pleiotropic manifestations involving the cardiovascular, ocular, skeletal, skin, lung, and central nervous systems. The disease’s diagnosis is based primarily on the clinical interaction of these systems as outlined in the Ghent nosology criteria. Mortality due to the disease is mainly associated with the development of cardiovascular events, such as heart failure, aortic aneurysm, and subsequent aortic dissection (1).
More than 90% of MFS cases are caused by pathogenic heterozygous variants which are encoded in the extracellular matrix glycoprotein fibrillin-1 (FBN1). Previous studies have been explored the relationship between the location and type of FBN1 mutations and the clinical outcomes of MFS patients (2). However, these efforts have been proven to be difficult by the known inter-familial and intra-familial clinical variability in MFS patients (3). Furthermore, mutations in FBN1 lead to different clinical disorders, such as non-syndromic familial thoracic aortic aneurysms, familial kyphoscoliosis, adolescent idiopathic scoliosis, and Weill-Marchesani syndrome et al. (4). FBN1 perform important biological functions as a calcium-binding microfibrillar structural molecule and a regulator of transforming growth factor β (TGF-β) signaling (5), beyond serving as scaffolds for elastin deposition. In this manner, the tissue-specific fibrillin microfibril network structure cooperated with biological functions to force influence on tissue growth and homeostasis (4). This indicates that more studies on genotype-phenotype correlation are warranted.
In this study we have sought to identify and determine how a novel variant in FBN1 might be responsible for early-onset familial thoracic aortic aneurysms (TAA) in MFS patients. We believe such research can contribute to improving the diagnosis and treatment of MFS patients with truncating variants in exons 42-65.
We present the following article in accordance with the MDAR reporting checklist (available at https://dx.doi.org/10.21037/atm-21-3104).
Methods
Ethical compliance
All procedures performed in this study involving human participants were in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee at the First Affiliated Hospital of Gannan Medical University (No. 201713104150) and informed consent was taken from all the patients.
Subjects and DNA preparation
The proband patient first presented to the hospital complaining of acute chest pain and was subsequently diagnosed with a thoracic aortic dissection according to a computed tomography angiogram (CTA). She was then diagnosed with MFS according to the 2010 revised Ghent nosology criteria (6). The clinical phenotype of her first-degree relatives was also investigated. After the relevant consent forms were signed, peripheral blood samples were collected from these relatives, and genomic DNA samples were isolated.
Next-generation DNA sequencing and variant calling
In light of the characteristic clinical features of MFS, the blood samples of the patient’s relatives were screened for the 13 genes associated with hereditary thoracic aortic disease (ACTA2, COL3A1, FBN1, FBN2, MYH11, MYLK, PLOD1, SLC2A10, SMAD3, TGFBR1, TGFBR2, EFEMP2, and ELN). This gene panel screening was carried out by using a next-generation sequencing (NGS) tool (Realomics Inc., Shenzhen, China). The average sequencing depth was 150 x, and qualified sequence reads were arrayed to the human reference genome (NCBI GRCh37) using the Burrows-Wheeler Aligner (version 0.5.17; http://bio-bwa.sourceforge.net/) (7). SAMtools (version 0.1.18, http://samtools.sourceforge.net/). Picard (http://picard.sourceforge.net/) and GATK (http://www.broadinstitute.org/gsa/wiki/index.php/Home_Page) were used for removing duplicate reads, alignments, and recalibrations. Potential single-nucleotide variants (SNVs) and small insertions and deletions (indel) were called and filtered using GATK3.7. High-confidence SNV and indel variants were then noted using snpEff (Version 4.2; http://snpeff.sourceforge.net/), and all variants were annotated according to the control population of the 1000 Genomes Project (2014 October release, http://www.1000genomes.org), ExAC (http://exac.broadinstitute.org), EVS (http://evs.gs.washington.edu/EVS), the disease databases of ClinVar (http://www.ncbi.nlm.nih.gov/clinvar), and Online Mendelian Inheritance in Man (OMIM; http://www.omim.org).
Statistical analysis
Considering MFS is a rare Mendelian disorder, we calculated the frequency of each variant in gene targets in the proband by using a large control dataset from 2504 individuals in the 1000 Genomes Project phase 5 dataset, which contains data from individuals from five “superpopulations” (European, African, East Asian, South Asian, and ad-mixed American). We repeated the analysis for variants filtered according to minor allele frequency (MAF) thresholds <0.05%. We then filtered rare variants according to two scenarios protein-altering variants and loss-of- function (LOF) variants. The interpretation of the pathogenicity of all genetic variants was undertaken following the guidelines of the American College of Medical Genetics and Genomics (8). In the genomic DNA of the patient, we classified a frameshift variant of the FBN1 gene as “pathogenic/likely pathogenic” due to multiple lines of pathogenic evidence. According to the above guidelines, this result details when a variant has a greater than 90% chance of being disease-causing. Mutationtaster2 was used (9) to further determine whether the putative functions of the mutations were disease causing.
Sanger sequencing
The frameshift variant of FBN1 (NM_000138.4) was confirmed by Sanger sequencing. The targeted fragment was amplified by polymerase chain reaction (PCR) using a primer pair (GCATCACCAACCCTCCAATC; TGCTGAGTCTACAAGTCTGGT). PCR products were purified and sequenced by Tianyi Huiyuan Inc. (Guangzhou, China).
Results
Family pedigree and patient information
The proband (II-1), a 39-year-old female, was admitted to the hospital due to acute chest pain and was diagnosed with Standford B aortic dissection according to CTA (Figure 1A). She was then treated with an endovascular stent graft that spanned from the aortic arch to the descending aorta. In addition to the patient’s aortic dissection, other clinical features of MFS were identified. These included the dilation of her carotid and pulmonary artery, as well as multiple skeletal disorders as described in Table 1. Her mother resembled the proband in looks and died at age 32 due to acute chest pain caused by aortic dissection. In accordance with the Ghent nosology criteria, the proband (II-1) was diagnosed as MFS because his features met the criteria that is a systemic score >7 and family history. The patient’s 14-year-old son also displayed a dilated aortic bulb at the descending aorta next to the aortic arch, the same rupture site as that of the patient’s dissection (Figure 1B), consequently was diagnosed MFS syndrome based on his family history and clinical phenotype.


Full table
Sequencing analysis
Given the high-mortality risk of the FBN1 variant, we performed genetic counseling and next-generation gene panel sequencing. Bioinformatic analysis revealed a novel FBN1 frameshift variant c.5081_5082insT (p. Leu1694Phefs*9) in exon 42 (chr15:48755421), which was further confirmed by Sanger sequencing (Figure 1C,1D). The heterozygous peak of Sanger sequencing for the 2 patients demonstrated that the indel mutation was not yet present in the unaffected relative (Figure 1C). The insertion variant was further confirmed using clone-based sequencing (Figure 1D). We also found that the mutation c.5081_5082insT did not exist in known databases (UMD-FBN1 (http://www.umd.be/), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), UCSC common SNP (http://genome.ucsc.edu/), dbSNP (http://www.bioinfo.org.cn/relative/dbSNP%20Home%20Page.htm), and the 1000 Genomes Project) or in published articles. These results reveal that the proband (II-1) passed this FBN1 variant to her son (III-1) and that the genotype is segregated by phenotype in this family.
Further analysis indicated that this insertion caused a change in amino acids 1694 to 1701 and a deletion of large fragments in amino acids 1702 to 2871 (Figure 1D). Compared to the wild-type gene, this truncated protein lacks 23 exons in the C-terminus, corresponding to 2 TGF-β domains, 18 cbEGF-like domains, and 1 fibulin-like domain (Figure 1E). We further determined that this gene variation likely affects protein function and may subsequently result in disease (as predicted by the MutationTaster2). In accordance with standards and guidelines for the interpretation of sequence variants developed by the American College of Medical Genetics and Genomics, c.5081_5082insT can be considered as a pathogenic variant of this MFS family accompanied with early-onset familial thoracic aortic aneurysms (8). Considering that MFS’s hereditary fashion, we also genotyped her little son at the pathogenic locus using Sanger sequencing and consequently excluded him as an MFS patient.
Discussion
The genotype-phenotype correlation was recognized as an important factor not only in diagnosis but also in the risk stratification and clinical management, of patients suspected to suffer from MFS (10). As MFS based purely on the mutation type is challenging, establishing a better genotype-phenotype correlation may prove to be an important step in the future treatment of MFS. In this case study of a Chinese family, we discovered that the novel insertion mutation c.5081_5082insT (p. Leu1694Phefs*9) is associated with MFS characterized by early-onset familial TAA and accompanying multiple skeletal defects. The presence of the premature termination codon truncates FBN1 protein, causes an haploinsufficiency (HI)-inducing effect, and consequently reduces the amount of functional FBN1.
The mutations that take place in FBN1 have been classified into different categories including missense, which has a so-called dominant negative (DN) effect, and frameshift, nonsense and splice, all of which have a HI effect (11). A few studies have observed a trend in the association between genotype and clinical outcomes. For example, in a multicenter clinical trial, Faivre et al. evaluated the effect of mutation type and location, concluding that MFS patients with truncating variants in FBN1 have a more severe skeletal and skin phenotype compared with MFS patients with missense mutations (2). Moreover, several single-center prospective cohort studies have analyzed the correlation between aortic events and mutation classifications in MFS patients, suggesting that those diagnosed with truncating variants in the FBN1 gene have a higher chance of experiencing an aortic event (10,12). Recently, Arnaud et al. further found that those truncating mutants not only experienced the high risk of aortic events but also consequently had a shorter life expectancy, compared with MFS patients with in-frame variants (13). Otherwise, Baudhin et al. observed that 48% of MFS patients with a truncating, or splicing variant did not report an aortic event (12). Unlike truncating mutations, the number of missense mutations were enough to establish the correlation between MFS severity and mutation location. The missense mutations in exons 24-32 had been proven consistently by several studies that these variants resulted in early onset aortic risk and even severe forms of MFS through a dominant negative effect (2). However, in this region, truncating variants were not associated with aortic risk (13). These findings suggest that further research into the location of the pathogenic truncating variants of individuals with MFS may have significant implications for understanding the severity of the disease.
In this present study, the FBN1 variant, c.5081_5082insT, was noted to cause a truncated C-terminus, resulting in a lack of 1169 amino acids translated by exons 42-65. The 2 patients diagnosed with the variant also fulfilled the criteria for skeletal and cardiovascular manifestation, but notably showed no ocular or skin anomalies. They both also had a positive wrist and thumb sign, with only the proband experiencing pectus carinatum, chest asymmetry, and scoliosis (Figure S1). What is also important to note is that the proband presented thoracic aortic dissection at 39 years of age, her mother died from aortic dissection at age 32, and her 14-year-old son has been identified as having an aortic sinus dilatation and a dilated aortic bulb at the descending aorta next to the aortic arch. This indicates that the c.5081_5082insT mutation caused by MFS has resulted in the patient’s son having a high-mortality risk, as well as a high risk of experiencing some form of aortic complication, which in the future may require surgery. Our study also identified that the patient’s son displayed some features of MFS which have not yet been defined as MFS in the Ghent nosology criteria, indicating the clinical values of etiological diagnosis and genetic counseling.
Ultimately, this research sheds further light on the important influence exons 42-65 have on aortic development. A previous report has described those patients with a mutation located in the 3’ region (exon 59-63) of FBN1 were associated with a mild phenotype characterized by a lack of significant aortic pathology (14). The fragment from exons 44-49 have also been proven to regulate the bioavailability of TGF-β and consequently contribute to Marfan pathogenesis (15). This has allowed us to recognize the important role TGF-β signaling plays in aortic aneurysm progression (16). Losartan, a TGF-β inhibitor, has also been noted to be particularly effective at reducing aortic root dilatation in MFS patients with HI FBN1 mutations as opposed to those with from DN mutations (17). Xu et al. reported that there was a significantly higher frequency of aortic dissection than aortic aneurysm in Marfan syndrome patients carried FBN1 frameshift and nonsense mutations, otherwise the in-frame mutants experienced the opposite tendency (18). Besides, the truncating mutations of FBN1 also contribute to non-syndromic sporadic or familial aortic aneurysms and dissections (19). Considering the severity of aortic involvement in truncating mutants, the location of truncating mutations in FBN1 associated with aortic events might enrich our knowledge on clinical management.
Conclusions
Through this study we have identified and confirmed a novel truncating mutation, c.5081_5082insT (p. Leu1694fs*9) in the FBN1 gene. This MFS mutation is characterized by early-onset familial TAA and is accompanied by variable skeletal manifestations. These findings make a significant contribution to research on the treatment and management of MFS patients with truncating variants in exons 42 to 65.
Acknowledgments
Funding: This work was financially supported by the National Natural Science Foundation of China (No. 31671288), the Innovation Team Foundation (No. TD201902), and the Science and Technology Project of Jiangxi Health Committee (No. 202130676).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://dx.doi.org/10.21037/atm-21-3104
Data Sharing Statement: Available at https://dx.doi.org/10.21037/atm-21-3104
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://dx.doi.org/10.21037/atm-21-3104). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All procedures performed in this study involving human participants were in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee at the First Affiliated Hospital of Gannan Medical University (No. 201713104150) and informed consent was taken from all the patients.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Franken R, Teixido-Tura G, Brion M, et al. Relationship between fibrillin-1 genotype and severity of cardiovascular involvement in Marfan syndrome. Heart 2017;103:1795-9. [Crossref] [PubMed]
- Faivre L, Collod-Beroud G, Loeys BL, et al. Effect of mutation type and location on clinical outcome in 1,013 probands with Marfan syndrome or related phenotypes and FBN1 mutations: an international study. Am J Hum Genet 2007;81:454-66. [Crossref] [PubMed]
- De Backer J, Loeys B, Leroy B, et al. Utility of molecular analyses in the exploration of extreme intrafamilial variability in the Marfan syndrome. Clin Genet 2007;72:188-98. [Crossref] [PubMed]
- Sakai LY, Keene DR, Renard M, et al. FBN1: The disease-causing gene for Marfan syndrome and other genetic disorders. Gene 2016;591:279-91. [Crossref] [PubMed]
- Verstraeten A, Alaerts M, Van Laer L, et al. Marfan Syndrome and Related Disorders: 25 Years of Gene Discovery. Hum Mutat 2016;37:524-31. [Crossref] [PubMed]
- Loeys BL, Dietz HC, Braverman AC, et al. The revised Ghent nosology for the Marfan syndrome. J Med Genet 2010;47:476-85. [Crossref] [PubMed]
- Li H, Handsaker B, Wysoker A, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009;25:2078-9. [Crossref] [PubMed]
- Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015;17:405-24. [Crossref] [PubMed]
- Schwarz JM, Cooper DN, Schuelke M, et al. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods 2014;11:361-2. [Crossref] [PubMed]
- Wang Y, Lian Z, Zhou Y, et al. Differential diagnosis of Marfan syndrome based on ocular biologic parameters. Ann Transl Med 2020;8:1354. [Crossref] [PubMed]
- Dietz HC. Potential Phenotype-Genotype Correlation in Marfan Syndrome: When Less is More? Circ Cardiovasc Genet 2015;8:256-60. [Crossref] [PubMed]
- Baudhuin LM, Kotzer KE, Lagerstedt SA. Increased frequency of FBN1 truncating and splicing variants in Marfan syndrome patients with aortic events. Genet Med 2015;17:177-87. [Crossref] [PubMed]
- Arnaud P, Milleron O, Hanna N, et al. Clinical relevance of genotype-phenotype correlations beyond vascular events in a cohort study of 1500 Marfan syndrome patients with FBN1 pathogenic variants. Genet Med 2021;23:1296-304. [Crossref] [PubMed]
- Palz M, Tiecke F, Booms P, et al. Clustering of mutations associated with mild Marfan-like phenotypes in the 3' region of FBN1 suggests a potential genotype-phenotype correlation. Am J Med Genet 2000;91:212-21. [Crossref] [PubMed]
- Chaudhry SS, Cain SA, Morgan A, et al. Fibrillin-1 regulates the bioavailability of TGFbeta1. J Cell Biol 2007;176:355-67. [Crossref] [PubMed]
- Holm TM, Habashi JP, Doyle JJ, et al. Noncanonical TGFβ signaling contributes to aortic aneurysm progression in Marfan syndrome mice. Science 2011;332:358-61. [Crossref] [PubMed]
- Franken R, den Hartog AW, Radonic T, et al. Beneficial Outcome of Losartan Therapy Depends on Type of FBN1 Mutation in Marfan Syndrome. Circ Cardiovasc Genet 2015;8:383-8. [Crossref] [PubMed]
- Xu S, Li L, Fu Y, et al. Increased frequency of FBN1 frameshift and nonsense mutations in Marfan syndrome patients with aortic dissection. Mol Genet Genomic Med 2020;8:e1041 [Crossref] [PubMed]
- Tan L, Li Z, Zhou C, et al. FBN1 mutations largely contribute to sporadic non-syndromic aortic dissection. Hum Mol Genet 2017;26:4814-22. [Crossref] [PubMed]
(English Language Editors: J. Goetz and J. Gray)