Y-box binding protein 1 regulates liver lipid metabolism by regulating the Wnt/β-catenin signaling pathway
Introduction
Non-alcoholic fatty liver disease (NAFLD) has emerged as the most prevalent condition that contributes to chronic hepatic ailments worldwide, and consists of a heterogeneous spectrum of diseases including simple steatosis, steatohepatitis, advanced fibrosis, and cirrhosis (1,2). Specifically, non-alcoholic steatohepatitis (NASH) can progress to liver cirrhosis and primary liver cancer, becoming the main cause of liver-related morbidity and mortality (3,4). Although the prevalence of NAFLD is closely associated with obesity, type 2 diabetes mellitus (T2DM), and insulin resistance, However, these researches mainly focus on the etiology, epidemiology and progression of lipid metabolism in NAFLD and the pathogenic mechanism of NAFLD is still poorly understood (5-7). The aim of this study is to investigate the molecular mechanism of NAFLD.
Y-box binding protein 1 (YB-1), as a member of the family of DNA/RNA-binding proteins, can regulate gene expression in the cytoplasm and the nucleus. Generally, YB-1 is recruited to mRNAs in the cytoplasm or it can bind to Y-box elements (CCAAT-box) in the promoter regions of some genes in the nucleus, thereby regulating their translation and transcription (8,9). Recently, an investigation demonstrated that YB-1 is involved in the progression of fatty acid synthesis (10). However, there is currently minimal research focused on the role of YB-1 in NAFLD pathogenic mechanisms.
Recently, some investigations have shown that Wnt/β-catenin signaling plays a pivotal role in liver inflammation and liver fibrosis development, together with chronic liver injury progression (11-13). In addition, some studies demonstrated that the Wnt/β-catenin signaling pathway can regulate lipid metabolism in the liver (14,15). We present the following article in accordance with the ARRIVE reporting checklist (available at https://dx.doi.org/10.21037/atm-21-5767).
Methods
Animals and the NAFLD mouse model
Thirty-five-day-old C57BL/6 mice were procured through Sino-British Sippr/BK Laboratory. Under specific pathogen-free conditions, they were housed at a constant temperature (22±2 °C) and 60% relative humidity, with 12:12-h light-dark cycle in the Animal Experimental Center of Bengbu Medical College (Bengbu, China). All the animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Bengbu Medical College and were approved by the Animal Ethics Committee of Bengbu Medical College (Bengbu, China) under a project license (No. 2021-096). Wild type C57BL/6 mice were divided into a normal diet group and a high-fat diet group (HFD—comprising 60% fat-derived calories) (BioServ™, Frenchtown, NJ, USA). The mice in the HFD group were fed in this manner for an uninterrupted timespan of 12 weeks. Meanwhile, the normal diet group was treated with a healthy balanced dietary intake (Keaoxieli™, Beijing, China).
Cell culture and establishment of the NAFLD model
LO2 hepatocytes were used in this study. The cell cultures were expanded in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher™, USA), supplemented with 10% fetal bovine serum (Thermo Fisher™, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin. For steatosis induction, the cells were treated with 0.4 mM palmitic acid (PA) to create an NAFLD model in vitro. The culture medium and PA were replaced every 24 h for 72 h.
Construction of YB-1 lentiviruses and β-catenin plasmid
A lentiviral vector LV-3 carrying a green fluorescent protein (GFP) reporter (GenePharma, Shanghai, China) was employed for expressing short hairpin RNA (shRNA) that targeted the YB-1 sequence (5'-GCCTAGAGAGGATGGCAATGA-3'), and an additional lentiviral vector LV-5/GFP reporter delivery system was employed for overexpressing RNA that targeted the YB-1 sequence (ID: 22608, NM_011732.2), with LV3 and LV5 (vector) as the control. pGMLV-SC5 RNAi carrying a GFP reporter (Genomeditech™, Shanghai, China) was employed for expressing shRNA that targeted β-catenin (5'-GCACCATGCAGAATACAAATG-3'), with PGMLV-6395 (vector) serving as the control plasmid. A PGMLV-6395/GFP reporter delivery system was employed for overexpressing RNA that targeted β-catenin (CTCGAGGCCACCGGATCC).
In brief, LO2 cells in medium were transfected using shYB-1, shβ-catenin, overexpressed YB-1, overexpressed β-catenin, and its corresponding vector with Lipofectamine 3000® (Invitrogen™, Carlsbad, CA) as per the manufacturer’s protocol. After an incubation period of 72 h, transcriptomic/proteomic quantitative LO2 cell analyses, from all experimental arms, were conducted using qRT-PCR and Western blotting.
Immunohistochemistry (IH)
For the IH process, formalin-fixed paraffin-embedded liver samples were cut into 4 µm sections, then deparaffinized and rehydrated. Antigen retrieval was performed using sodium citrate (20 min). Samples were then incubated in 3% H2O2 (15 min), pretreated by boiling in 10 mM sodium citrate buffer (pH 6.0) (20 min), and then washed 3 times with phosphate-buffered saline (PBS). Blocking was performed in 5% bovine serum albumin (BSA) for 0.5 h at room temperature. The primary antibodies in 1% BSA were incubated overnight at 4 °C in a humid chamber. After horseradish peroxidase-conjugated secondary antibody incubation for 0.5 h at room temperature, the specimens were counter-stained using 4',6-diamidino-2-phenylindole (DAPI). Staining of each liver tissue sample was repeated 3 times. Lastly, the Barnes method was employed as the immune scoring system. Details of the primary/secondary antibodies are listed in Table 1.
Table 1
| Antibody | Dilution | Supplier | Product ID |
|---|---|---|---|
| YB-1 | 1:1,000 (WB), 1:20 (IP), 1:250 (IH) | Abcam | ab76149 |
| LXRa | 1:5,000 (WB) | Abcam | ab176323 |
| pGSK3β | 1:40 (IP), 1:500 (WB) | Abcam | ab68476 |
| IgG | 1:15 (IP) | Abcam | ab6728 |
| GAPDH | 1:5,000 (WB) | Abcam | ab8245 |
| β-catenin | 1:10,000 (WB), 1:250 (IH) | Abcam | ab32572 |
| FXR1 | 1:10,000 (WB) | Abcam | ab129089 |
| PPARα | 1:500 (WB) | Abcam | ab3484 |
| TNFα | 1:1,000 (WB) | Abcam | ab183218 |
| SREBP-1c | 1:1,000 (WB), 1:200 (IH) | Thermo Fisher | PA5-99371 |
| IL-6 | 1:1,000 (WB) | Abcam | ab259341 |
YB-1, y-box binding protein 1; LXRa, Liver X Receptor α; pGSK3β, phosphorylation glycogen synthase kinase 3 beta; IgG, immunoglobulin G; GAPDH, reduced glyceraldehyde-phosphate dehydrogenase; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha; TNFα, tumor necrosis factor α, SREBP-1c, sterol regulatory element binding protein-1c; IL-6, interleukin 6.
Hematoxylin and eosin (H&E) and Oil Red O staining
H&E staining was performed to observe the degree of liver inflammation. Formalin-fixed paraffin-embedded liver samples were cut into 3 µm sections and stained with H&E (Beyotime™, China), followed by light microscopy-based visualization. In addition, hepatic cryosections were stained using an Oil Red O kit (Sigma, USA) and counter-stained using hematoxylin in order to observe lipid droplets under light microscopy.
Quantitative Real-time PCR (qRT-PCR)
Total RNA was extracted from liver tissues using TRIzol™ reagent (Thermo Fisher, USA) and then reverse transcribed into cDNA using Hieff™ First Strand cDNA Synthesis Super Mix for qRT-PCR (Yeasen, China). Hieff qPCR SYBR Green Master Mix® (Applied Biosystems™, CA, USA) together with Hieff First Strand cDNA Synthesis Super Mix for qRT-PCR® (Applied Biosystems™) were employed for qPCR. All experiments were repeated 3 separate times. GAPDH served as a normalization/reference gene. Primer sequences are illustrated in Table 2.
Table 2
| Target | Forward primer | Reverse primer |
|---|---|---|
| YB-1 | TAGACGCTATCCACGTCGTAG | ATCCCTCGTTCTTTTCCCCAC |
| SREBP-1c | ACAGTGACTTCCCTGGCCTAT | GCATGGACGGGTACATCTTCAA |
| LXRa | ACACCTACATGCGTCGCAAG | GACGAGCTTCTCGATCATGCC |
| FXR1 | CTGCGACAGATTGGTTCTAGG | TGTACCATAACCGGAGGTGTAA |
| PPARα | TTCGCAATCCATCGGCGAG | CCACAGGATAAGTCACCGAGG |
| β-catenin | AGCTTCCAGACACGCTATCAT | CGGTACAACGAGCTGTTTCTAC |
YB-1, y-box binding protein 1; SREBP-1c, sterol regulatory element binding protein-1c; LXRa, Liver X Receptor α; FXR1, farnesoid X receptor1; PPARα, peroxisome proliferator-activated receptor-alpha.
Western blotting (WB) assay
Total protein was extracted with RIPA lysis buffer (Thermo Fisher, USA). Equivalent protein sample quantities (70 µg) were separated through 10% SDS-PAGE and then transferred onto PVDF membranes (0.22 µm). Subsequently, membranes were blocked using 5% skimmed milk + 0.1% Tris Buffered Saline Tween (TBST) for 1 h at room temperature, followed by incubation with primary antibodies at 4 °C overnight. Membranes were washed 3 times with TBST and then incubated with the corresponding secondary antibody for 1 h at room temperature. Bands were identified through the enhanced chemiluminescence (ECL) (Thermo Fisher, USA) system, followed by X-ray radiation (LAS MINI 4000®, Japan). The protein expression levels of individual bands were assessed through ImageJ (National Institute of Health, Bethesda, MD, USA). Each assay was performed in triplicate across individual experiments. GAPDH served as a normalization protein for protein expression assessments. Details of primary antibodies are listed in Table 1.
Tandem mass tag proteomics
SDT pyrolysis methods were used to extract proteins for proteomics, and the bicinchoninic acid (BCA) kit (Pierce™ BCA, Thermo Fisher, USA) was used to test sample concentrations. The loading buffer (6x) was added to 20 µg protein samples, which were then boiled for 5 min, separated by 12% SDS-PAGE, and stained by Coomassie bright blue. Enzymatic hydrolysis was then performed through FASP, tagged by TMT, and separated through High PH RP. Subsequently, mass spectrometry was performed using the Easy nLC system and mass spectrum identification was performed by Q Exactive. Using Blast2 Gene Ontology (GO) to annotate the target protein, the process consisted of sequence alignment (blast), GO item extraction (mapping), GO annotation (annotation), and supplementary annotation augmentation. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed through KOALA (KEGG Orthology And Links Annotation), and enrichment analysis of GO/KEGG annotations was performed by Fisher’s exact test. Protein cluster analysis was performed using matplotlib software.
Co-immunoprecipitation (Co-IP)
Pierce Co-IP kits (Thermo Fisher, USA) were applied to extract total protein from LO2 cells, and the protein levels were evaluated using a BCA protein quantification kit (Thermo Fisher, USA). The experiment was conducted according to the Pierce Co-IP kit guidelines. In brief, pre-cleared lysate was set using control agarose resin. Subsequently, immobilized anti-YB-1 (20 µg/mg lysate) and anti-pGSK3β (40 µg/mg lysate), together with control IgG antibodies (20 µg/mg lysate), were introduced into the amino link/coupling resin solution. A 400 µg sample of pre-cleared lysate was incubated with various immobilization antibodies at 4 °C for 12 h and then the mixture was washed with 60 µL of elution buffer. All immune precipitates were boiled for 10 min and evaluated through a WB assay. Details of the primary antibodies are illustrated in Table 1.
Enzyme-linked immunosorbent assay (ELISA)
The supernatants of non-steatosis and steatosis LO2 cells grown in 12-well plates were harvested on day 3 and frozen at −20 °C until assay. A quantitative ELISA kit for TNFα (Murine TNF-α ELISA Kit, PeproTech, USA, BGK06804) was used to detect the concentration of TNFα in supernatants according to the manufacturer’s protocol. A quantitative ELISA kit for IL-6 (IL-6 Mouse ELISA Kit, Thermo Fisher, USA, BMS603-2) was used to detect the concentration of IL-6 in supernatants, as per the manufacturer’s protocol. A histogram of the TNFα and IL-6 concentration was created using GraphPad Prism® (GraphPad Software Inc.™, USA, version 8.0).
Statistical analysis
Data were presented as mean ± SE. All statistical analyses were conducted through SPSS 20.0® software (IBM™ SPSS; Armonk, NY, USA). Two-way ANOVA was applied to interpret the differences between treatment groups. P<0.05 indicated a statistically significant result.
Results
The expression levels of YB-1 and β-catenin were higher in NAFLD liver tissues
After mice were fed with a HFD or normal diet for 12 weeks continuously, the liver samples were collected and used in experiments. Lipid deposits were increased in NAFLD liver tissues compared with normal liver tissues (Figure 1A). The degree of inflammatory response was more serious compared to that of normal liver tissues (Figure 1B). Subsequently, we found that the expression of YB-1 protein was higher in the NAFLD group (Figure 1C,1D). Furthermore, qRT-PCR/WB indicated that YB-1 mRNA and protein expression was upregulated in the NAFLD group (Figure 1E-1G). Interestingly, we found that the protein and gene expression of β-catenin was also higher in the NAFLD group (Figure 1H-1J). At the same time, the expression levels of TNFα and IL-6 were higher in the NAFLD group compared with the normal liver group (Figure 1K,1L).
The expression levels of YB-1 and β-catenin were increased in the LO2 cell NAFLD model in vitro
To further explore the correlation between YB-1 and β-catenin in hepatocyte steatosis, we established an LO2 cell NAFLD model in vitro through cultured LO2 cells in DMEM induced by PA (Figure 2A). We found that the expression levels of genes and proteins related to lipid synthesis (SREBP-1c and LXRa) were higher in steatosis LO2 cells, but the expression levels of genes and proteins related to β-oxidation (FXR1 and PPARα) were lower (Figure 2B-2D). Furthermore, we also found that the gene and protein expression levels of YB-1 and β-catenin were elevated in steatosis LO2 cells (Figure 2E-2G). Finally, the inflammation factors TNFα and IL-6 were also increased in steatosis LO2 cells (Figure 2H,2I).
YB-1 regulated lipid synthesis and the expression of β-catenin in LO2 cells
In order to investigate the effect of YB-1 on LO2 cell lipid synthesis and the expression of β-catenin, a YB-1 lentivirus was constructed to regulate the gene and protein expression levels of YB-1. Subsequently, non-steatosis and steatosis LO2 cells were transfected with the YB-1 lentivirus and its corresponding vector, and the RNA and protein were collected for experiments at the indicated time. First, we confirmed that shYB-1 lentivirus could effectively inhibit and overexpression YB-1 lentivirus could effectively increase the gene and protein expression levels of YB-1 (Figure 3A,3B). Second, in steatosis LO2 cells, we demonstrated that downregulation of YB-1 inhibited lipid synthesis, but upregulation of YB-1 promoted lipid synthesis (Figure 3C). Furthermore, we found that downregulation of YB-1 inhibited the expression of SREBP-1c and LXRa mRNA, but increased the expression of FXR1 and PPARα mRNA. However, upregulation of YB-1 promoted the expression of SREBP-1c and LXRa mRNA, but inhibited the expression of FXR1 and PPARα mRNA (Figure 3D-3G). Third, the WB assay showed that the protein expression levels of SREBP-1c, LXRa, FXR1, and PPARα were consistent with their mRNA expression levels. At the same time, we also found that downregulation of YB-1 inhibited the expression level of β-catenin protein, but upregulation of YB-1 increased the expression level of β-catenin protein (Figure 3H,3I). Finally, the results showed that inhibited lipid synthesis by shYB-1 downregulated the contents of TNFα and IL-6 in the corresponding supernatant, but increased lipid synthesis induced by overexpression of YB-1 upregulated the contents of TNFα and IL-6 (Figure 3J,3K).
YB-1 combined with pGSK3β to regulate the expression of β-catenin in LO2 cells
In order to examine the molecular mechanisms of YB-1 in regulating β-catenin levels in LO2 cells, we conducted a tandem mass tag proteomics assay. LO2 cells were transfected with shYB-1 lentivirus and cultured in DMEM + PA for 72 h, and then total protein was extracted for experiments. The results showed that a total of 300 proteins were upregulated and 376 proteins were downregulated upon downregulation of YB-1 (Figure 4A). GO analysis of the upregulated proteins revealed that YB-1 downregulation promoted proteins associated with oxide synthase activity and glucose homeostasis (Figure 4B). KEGG pathway analysis demonstrated enrichment in the complement and coagulation, ferroptosis, and PI3K-AKT pathways (Figure 4C). WB confirmed that the downregulation of YB-1 upregulated pGSK-3β and downregulated β-catenin, but upregulation of YB-1 led to pGSK-3β downregulation and upregulated β-catenin (Figure 4D,4E). Subsequently, a Co-IP assay showed that YB-1 complexed pGSK3β (Figure 4F). Such findings suggest that the YB-1-regulated Wnt/β-catenin signaling pathway could be orchestrated through pGSK3β degradation. Consequently, the LO2 cell line was exposed to a GSK3β inhibitor (TDZD-8; f.c. 2.5 µM) and activator (recombinant murine GSK3β protein (rGSK3β)) at 90 ng/mL once daily in DMEM + PA for 72 h. WB demonstrated that TDZD-8 effectively led to pGSK3β downregulation, together with inducing β-catenin (and its target protein CyclinD1) upregulation. In contrast, rGSK3β demonstrated contrasting influences on the Wnt/β-catenin signaling pathway, suggesting that β-catenin is a downstream target of pGSK3β (Figure 4G,4H). Therefore, we constructed shβ-catenin and a corresponding scramble, and OE-β-catenin together with empty-vector plasmids. Study outcomes indicated that shβ-catenin and OE-β-catenin regulate β-catenin at the transcriptomic and proteomic levels (Figure 4I-4L). Moreover, we confirmed that downregulation of β-catenin and its target CyclinD1 by shYB-1 could be rescued by OE-β-catenin, and upregulation of β-catenin and its target CyclinD1 by OE-YB-1 could be inhibited by shβ-catenin (Figure 4M,4N).
Reverse regulation of β-catenin reversed the effect of YB-1 on lipid synthesis in LO2 cells
To further investigate whether the effect of YB-1 on LO2 cell lipid synthesis was realized by regulating β-catenin, Oil Red O staining was applied to observe lipid synthesis in LO2 cells cultured in DMEM + PA for 72 h. The results showed that downregulation of YB-1 impeded lipid synthesis, although this effect was reversed through β-catenin overexpression. In addition, upregulation of YB-1 increased lipid synthesis, but this phenomenon could be abolished by downregulation of β-catenin (Figure 5A). Then, WB assays demonstrated that downregulation of YB-1 inhibited the expression levels of SREBP-1c and LXRa, and increased the expression levels of FXR1 and PPARα. However, this phenomenon could be reversed by overexpression of β-catenin. Furthermore, the results also indicated that upregulation of YB-1 increased the expression levels of SREBP-1c and LXRa, and decreased the expression levels of FXR1 and PPARα, but this phenomenon could also be reversed by downregulation of β-catenin (Figure 5B,5C). RT-PCR showed that the relative gene expression levels of SREBP-1c, LXRa, FXR1, and PPARα were consistent with the protein expression levels (Figure 5D). Finally, ELISA assays confirmed that the concentrations of TNFα and IL-6 in the supernatants were consistent with the degree of steatosis in the above groups (Figure 5E,5F).
YB-1 regulated lipid synthesis in hepatocytes through orchestrating the Wnt/β-catenin signaling pathway in a mouse model
The results of the in vivo study indicated that YB-1 was highly expressed in NAFLD livers, but YB-1 expression was effectively inhibited by downregulation of YB-1, and YB-1 expression was higher with upregulation of YB-1 (Figure 6A,6B). In addition, this study also identified β-catenin upregulation in NAFLD livers, although the expression of β-catenin was significantly inhibited by downregulation of YB-1, and the expression of β-catenin was significantly increased by upregulating β-catenin (Figure 6C,6D). However, reverse regulation of β-catenin could reverse the effect of YB-1 on the β-catenin expression (Figure 6E,6F). Furthermore, Oil Red O staining demonstrated that downregulation of YB-1 inhibited lipid synthesis in NAFLD mouse livers, but upregulation of YB-1 promoted lipid synthesis (Figure 6G). Interestingly, the effect of YB-1 on lipid synthesis in NAFLD mouse livers could be reversed by reverse regulation of β-catenin (Figure 6H). WB indicated that the inhibited expression of SREBP-1c and LXRa by downregulating YB-1 could be rescued by upregulation of β-catenin, and the increased expression of FXR1 and PPARα by downregulating YB-1 could also be inhibited by upregulation of β-catenin. The increased expression of SREBP-1c and LXRa by upregulating YB-1 could be rescued by downregulation of β-catenin, and the inhibited expression of FXR1 and PPARα by upregulating YB-1 could also be increased by downregulation of β-catenin (Figure 6I,6J). Finally, we also confirmed that the expression levels of TNFα and IL-6 in NAFLD livers were consistent with the degree of steatosis (Figure 6K,6L).
Discussion
NAFLD is increasing year by year, posing a great burden to human health and society, and affecting 20–30% of the population worldwide (16). Excessive accumulation of triglycerides in hepatocytes is the hallmark of NAFLD, which is due to the imbalance between lipid deposition and clearance (17). Although investigators have recently reported the molecular mechanisms of NAFLD pathogenesis (18-20), they still require further research. In this study, we first found that the expression levels of YB-1 and β-catenin were elevated in mouse NAFLD livers. Then, in vitro analysis confirmed that the effect of YB-1 on lipid synthesis and β-oxidation in LO2 cells was facilitated by regulating the Wnt/β-catenin signaling pathway. Additional analyses identified that YB-1 develops a complex with pGSK3β to regulate the Wnt/β-catenin signaling pathway and its target CyclinD1 in steatosis LO2 cells. Finally, we also confirmed that the effect of YB-1 on lipid synthesis and β-oxidation in mouse NAFLD livers was facilitated by regulating the Wnt/β-catenin signaling pathway.
Recent investigations have confirmed that YB-1, as a member of the cold shock protein family, plays a pivotal role in the progression of liver injury and fibrosis, and the initiation and development of hepatic carcinoma (21-23). In our previous study, we found that YB-1 regulated Collagen I secretion in hepatic progenitor cells via PDGFR-β/ERK/p90RSK Signalling, and influenced the progression of liver fibrogenesis (24). Liu and colleagues found that t YB-1 augments sorafenib resistance through the PI3K/Akt signaling pathway in HepG2, a human hepatocarcinoma cell line (25). Wang and colleagues demonstrated that in acute liver injury model in C57BL/6J mouse induced by Lipopolysaccharide/D-galactosamine, phosphorylation YB-1 inhibition could downregulate the expression of Nlrp3 inflammasome, and protecting acute liver injury (23). Interestingly, McCauley et al. found that YB-1 participated in fatty acid synthesis in clear cell renal carcinoma (10). However, up to now, there have been few studies on the effects of YB-1 on lipid metabolism in hepatocytes. This investigation demonstrated YB-1 upregulation in mouse NAFLD livers and steatosis LO2 cells induced by PA.
To investigate the correlation between the expression level of YB-1 and lipid metabolism, we established an LO2 cell NAFLD model in vitro, and confirmed that YB-1 was highly activated in the progression of LO2 cell lipid synthesis. Meanwhile, fat synthetases SREBP-1c and LXRa were also highly activated, while β-oxidation-related enzymes FXR1 and PPARα were inhibited. We also found that the concentrations of inflammatory cytokines TNFα and IL-6 were higher in the supernatants of the steatosis LO2 cell group. Follow-up investigations revealed that inhibiting YB-1 through YB-1 gene silencing decreased lipid synthesis and the expression levels of SREBP-1c and LXRa, but increased the expression levels of FXR1 and PPARα. However, YB-1 upregulation by YB-1 gene overexpression increased lipid synthesis and the expression levels of SREBP-1c and LXRa, but decreased the expression levels of FXR1 and PPARα. Finally, we also found that the concentrations of TNFα and IL-6 were lower in the supernatants of LO2 cells transfected with a lentivirus of YB-1 gene silencing, but the concentrations of TNFα and IL-6 were higher in the supernatants of LO2 cells transfected with a lentivirus of YB-1 overexpression. These data indicated that YB-1 could participate in LO2 cell lipid metabolism.
GSK3β is a main protein of the multi-protein destruction complex. In unstimulated cells, the ubiquitin proteases after phosphorylation by GSK3β were shown to degrade β-catenin, which resulted in β-catenin not being able to translocate to the cell nucleus, and the Wnt/β-catenin signaling pathway was inactivated. In unstimulated cells, non-phosphorylated cytoplasmic β-catenin translocated/accumulated within the nucleus to enable downstream gene regulatory activity (26,27). Recently, a series of investigations indicated that the activation of the Wnt/β-catenin signaling pathway contributes to liver injury induced by alcohol consumption (13), and its downregulation increased the levels of proteins involved in glucose aerobic metabolism and β-oxidation in a mouse swimming training model (28). The above data demonstrate that the Wnt/β-catenin signaling pathway plays an important role in inflammation and metabolism, though the involvement of Wnt/β-catenin signaling in lipid metabolism and the inflammatory response of the liver remains uncertain. This investigation confirmed that enhanced triggering of Wnt/β-catenin took place in the process of liver and LO2 cell steatosis in vivo and in vitro, and that inhibiting the expression of YB-1 by downregulating the YB-1 gene suppressed the activation of this pathway and then decreased lipid synthesis and inflammatory responses. These findings were reversed through β-catenin overexpression. Next, we confirmed that promoting the expression of YB-1 by upregulating YB-1 gene expression increased the activation of this pathway and then increased lipid synthesis and inflammatory responses. However, this phenomenon was reversed by inhibition of β-catenin.
These results were similar to previous studies which indicated that the accumulation of β-catenin in the nucleus promoted lipogenesis in fish, and pGSK3β, a phosphorylated form of GSK3β, could form a destruction complex with other proteins to regulate Wnt/β-catenin triggering (29,30). In addition, this investigation also revealed that the inhibition of pGSK3β could activate the Wnt/β-catenin signaling pathway, but that increased pGSK3β suppressed the activation of this pathway, similar to the findings of previous studies (31-33). Recently, some investigations found that YB-1 could form protein complexes with other proteins to perform a series of physiological functions (34,35). In this study, we also found that YB-1 could form a complex with pGSK3β to regulate the Wnt/β-catenin signaling pathway. Although this investigation of the molecular mechanisms underlying liver lipid metabolism and inflammatory responses did not bring about extensive evidence, such results can certainly provide further insights into the mechanisms of liver lipid metabolism.
Acknowledgments
Funding: This study was supported by the Key Project of Natural Science Research of Universities of Anhui Province, Grant/Award Number: KJ2019A0369.
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://dx.doi.org/10.21037/atm-21-5767
Data Sharing Statement: Available at https://dx.doi.org/10.21037/atm-21-5767
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://dx.doi.org/10.21037/atm-21-5767). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All the animal procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Bengbu Medical College and were approved by the Animal Ethics Committee of Bengbu Medical College (Bengbu, China) under a project license (No. 2021-096).
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Chalasani N, Younossi Z, Lavine JE, et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology 2018;67:328-57. [Crossref] [PubMed]
- European Association for the Study of the Liver (EASL). European Association for the Study of Obesity (EASO). EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease. J Hepatol 2016;64:1388-402. [Crossref] [PubMed]
- Berardo C, Di Pasqua LG, Cagna M, et al. Nonalcoholic Fatty Liver Disease and Non-Alcoholic Steatohepatitis: Current Issues and Future Perspectives in Preclinical and Clinical Research. Int J Mol Sci 2020;21:9646. [Crossref] [PubMed]
- Kucukoglu O, Sowa JP, Mazzolini GD, et al. Hepatokines and adipokines in NASH-related hepatocellular carcinoma. J Hepatol 2021;74:442-57. [Crossref] [PubMed]
- Ji D, Qin E, Xu J, et al. Non-alcoholic fatty liver diseases in patients with COVID-19: A retrospective study. J Hepatol 2020;73:451-3. [Crossref] [PubMed]
- Liu XL, Pan Q, Cao HX, et al. Lipotoxic Hepatocyte-Derived Exosomal MicroRNA 192-5p Activates Macrophages Through Rictor/Akt/Forkhead Box Transcription Factor O1 Signaling in Nonalcoholic Fatty Liver Disease. Hepatology 2020;72:454-69. [Crossref] [PubMed]
- Sarkar M, Grab J, Dodge JL, et al. Non-alcoholic fatty liver disease in pregnancy is associated with adverse maternal and perinatal outcomes. J Hepatol 2020;73:516-22. [Crossref] [PubMed]
- Lyabin DN, Eliseeva IA, Ovchinnikov LP. YB-1 protein: functions and regulation. Wiley Interdiscip Rev RNA 2014;5:95-110. [Crossref] [PubMed]
- Kretov DA, Mordovkina DA, Eliseeva IA, et al. Inhibition of Transcription Induces Phosphorylation of YB-1 at Ser102 and Its Accumulation in the Nucleus. Cells 2019;9:104. [Crossref] [PubMed]
- McCauley C, Anang V, Cole B, et al. Potential Links between YB-1 and Fatty Acid Synthesis in Clear Cell Renal Carcinoma. Med Res Arch 2020; [Crossref] [PubMed]
- Weiskirchen R. Commentary on "Re-regulation of hepatic stellate cell contraction and cirrhotic portal hypertension by Wnt/β-catenin signaling via interaction with Gli1". Br J Pharmacol 2021;178:378-80. [Crossref] [PubMed]
- Zhang R, Kikuchi AT, Nakao T, et al. Elimination of Wnt Secretion From Stellate Cells Is Dispensable for Zonation and Development of Liver Fibrosis Following Hepatobiliary Injury. Gene Expr 2019;19:121-36. [Crossref] [PubMed]
- Xu Y, Chen D, Lin XX, et al. The LRP6 functional mutation rs2302685 contributes to individual susceptibility to alcoholic liver injury related to the Wnt/β-catenin-TCF1-CYP2E1 signaling pathway. Arch Toxicol 2019;93:1679-95. [Crossref] [PubMed]
- El-Derany MO, El-Demerdash E. Pyrvinium pamoate attenuates non-alcoholic steatohepatitis: Insight on hedgehog/Gli and Wnt/β-catenin signaling crosstalk. Biochem Pharmacol 2020;177:113942 [Crossref] [PubMed]
- Hatano M, Ojima H, Masugi Y, et al. Steatotic and nonsteatotic scirrhous hepatocellular carcinomas reveal distinct clinicopathological features. Hum Pathol 2019;86:222-32. [Crossref] [PubMed]
- Estes C, Anstee QM, Arias-Loste MT, et al. Modeling NAFLD disease burden in China, France, Germany, Italy, Japan, Spain, United Kingdom, and United States for the period 2016-2030. J Hepatol 2018;69:896-904. [Crossref] [PubMed]
- Eslam M, Valenti L, Romeo S. Genetics and epigenetics of NAFLD and NASH: Clinical impact. J Hepatol 2018;68:268-79. [Crossref] [PubMed]
- Song J, Liu Y, Wan J, et al. SIMPLE is an endosomal regulator that protects against non-alcoholic fatty liver disease by targeting the lysosomal degradation of EGFR. Hepatology 2021; [Epub ahead of print]. [Crossref]
- Tanwar S, Srivastava A, Rosenberg W. Errors in modeling misrepresent the utility of the enhanced liver fibrosis test in the management of non-alcoholic fatty liver disease. J Hepatol 2020;73:1580-1. [Crossref] [PubMed]
- Zhao Q, Liu J, Deng H, et al. Targeting Mitochondria-Located circRNA SCAR Alleviates NASH via Reducing mROS Output. Cell 2020;183:76-93.e22. [Crossref] [PubMed]
- Li D, Liu X, Zhou J, et al. Long noncoding RNA HULC modulates the phosphorylation of YB-1 through serving as a scaffold of extracellular signal-regulated kinase and YB-1 to enhance hepatocarcinogenesis. Hepatology 2017;65:1612-27. [Crossref] [PubMed]
- Xiong P, Zhang J, Xu D, et al. Positive feedback loop of YB-1 interacting with Smad2 promotes liver fibrosis. Biochem Biophys Res Commun 2017;484:753-61. [Crossref] [PubMed]
- Wang F, Gong S, Wang T, et al. Soyasaponin II protects against acute liver failure through diminishing YB-1 phosphorylation and Nlrp3-inflammasome priming in mice. Theranostics 2020;10:2714-26. [Crossref] [PubMed]
- Li F, Ma Z, Liu H, et al. Y-box Protein-1 Regulates the Expression of Collagen I in Hepatic Progenitor Cells via PDGFR-β/ERK/p90RSK Signalling. Stem Cells Int 2017;2017:6193106 [Crossref] [PubMed]
- Liu T, Xie XL, Zhou X, et al. Y-box binding protein 1 augments sorafenib resistance via the PI3K/Akt signaling pathway in hepatocellular carcinoma. World J Gastroenterol 2021;27:4667-86. [Crossref] [PubMed]
- Koch S. Regulation of Wnt Signaling by FOX Transcription Factors in Cancer. Cancers (Basel) 2021;13:3446. [Crossref] [PubMed]
- Steinhart Z, Angers S. Wnt signaling in development and tissue homeostasis. Development 2018;145:dev146589 [Crossref] [PubMed]
- Balatskyi VV, Palchevska OL, Bortnichuk L, et al. β-Catenin Regulates Cardiac Energy Metabolism in Sedentary and Trained Mice. Life (Basel) 2020;10:357. [Crossref] [PubMed]
- Xu YC, Xu YH, Zhao T, et al. Waterborne Cu exposure increased lipid deposition and lipogenesis by affecting Wnt/β-catenin pathway and the β-catenin acetylation levels of grass carp Ctenopharyngodon idella. Environ Pollut 2020;263:114420 [Crossref] [PubMed]
- Kuncewitch M, Yang WL, Molmenti E, et al. Wnt agonist attenuates liver injury and improves survival after hepatic ischemia/reperfusion. Shock 2013;39:3-10. [Crossref] [PubMed]
- Wang D, Lu G, Shao Y, et al. MiR-182 promotes prostate cancer progression through activating Wnt/β-catenin signal pathway. Biomed Pharmacother 2018;99:334-9. [Crossref] [PubMed]
- Sun YC. Examination of effects of GSK3beta phosphorylation, beta-catenin phosphorylation, and beta-catenin degradation on kinetics of Wnt signaling pathway using computational method. Theor Biol Med Model 2009;6:13. [Crossref] [PubMed]
- Martin E, Agazie YM. SHP2 Potentiates the Oncogenic Activity of β-Catenin to Promote Triple-Negative Breast Cancer. Mol Cancer Res 2021; [Epub ahead of print]. [Crossref] [PubMed]
- Liu J, Qu L, Wan C, et al. A novel β2-AR/YB-1/β-catenin axis mediates chronic stress-associated metastasis in hepatocellular carcinoma. Oncogenesis 2020;9:84. [Crossref] [PubMed]
- Yang F, Chen S, He S, et al. YB-1 interplays with ERα to regulate the stemness and differentiation of ER-positive breast cancer stem cells. Theranostics 2020;10:3816-32. [Crossref] [PubMed]
(English Language Editor: C. Betlzar)

