IL-36β promotes anti-tumor effects in CD8+ T cells by downregulating micro-RNA let-7c-5p
Introduction
There are many bottlenecks in tumor immunotherapy, including tumor immune escape in the tumor microenvironment (TME) (1,2). The main manifestation of immune escape is the weakening and blunting of the proliferative capacity of T lymphocytes. Tumor cells cannot be cleared in time, and the secretion of cytokines is reduced; consequently, immune effector cells cannot be activated (3). Studies have shown that high levels of Th1 and CD8+ T cells in the tumor significantly improve the prognosis of patients (4). This suggests reversing immune suppression in the TME is critical for successful immunotherapy in cancer. Some cytokines can reverse the inhibitory TME, so that disabled helper T cells (especially Th1 cells), cytotoxic T cells (CD8+ T cells), etc. regain anti-tumor functions and exert anti-tumor effects (5).
The immune microenvironment of pancreatic cancer is composed of tumor cells, pancreatic astrocytes, immune cells, and extracellular matrix, and expresses a variety of tumor antigens, such as mucin 1 (MUC1), mesothelin (MSLN), CEA, etc. In different pancreatic cancer tissues, tumor progression is divided into three stages: clearance, balance, and escape. The elimination phase is mainly anti-tumor immunity, the escape phase is mainly immunosuppression, and the equilibrium phase has both. Immune cells infiltrated in the microenvironment of pancreatic cancer are characterized by immunosuppression. Pancreatic cancer cells can edit the immune system so that it cannot be recognized by the immune system. At the same time, it can recruit and activate various immunosuppressive cells such as pancreatic stellate cells, myeloid-derived suppressor cells, tumor-associated macrophages and regulatory T cells, etc., then secrete immunosuppressive molecules to inhibit the host’s anti-tumor immune response, cause tumor immune escape, and promote the progression of pancreatic cancer. Hamanaka et al. (6) found that pancreatic cancer patients with positive serum MUC1-IgG had a better prognosis, and the level of serum MUC1-IgG was related to the survival of patients. With the development of technologies such as next-generation sequencing and single-cell sequencing, it is helpful to the study of the heterogeneity of malignant tumors and the screening of immune-related biomarkers of pancreatic cancer.
Interleukin (IL)-36 represents a group of pro-inflammatory cytokines, including IL-36α, IL-36β, and IL-36γ. IL-36’s receptor is IL-36R, formerly termed IL-1 receptor-associated protein 2 (IL-1Rpr2) (7). IL-36R expression was detected on CD4+ T, CD8+ T, natural killer (NK), and γδT cells (8). IL-36 regulates dendritic cell (DC) and CD4+ T cell functions, and promotes INF-γ and IL-2 secretion (9,10). B16 and 4T1 cells with high IL-36γ expression can significantly inhibit tumor cell proliferation and lung metastasis, promote interferon-gamma (IFN-γ) secretion, and increase CD8+ T, NK, and γδT cell infiltration into tumors (11). Our previous research found that IL-36β promotes CD8+ T cell activation by inducing mammalian target of rapamycin complex 1 (mTORC1) via PI3K/Akt (12). Therefore, we hypothesized that IL-36β can also stimulate Th1-type immune responses to play an anti-tumor role.
MicroRNAs (miRNAs, i.e., non-coding single-stranded RNAs averaging 22 nt) mostly regulate genes via binding to the 3'UTRs of the mRNA targets, promoting mRNA degradation or suppressing translation (13). Abnormal miRNA expression is implicated in multiple pathologies, including numerous human malignancies, including lung, gastric, and breast cancers (14-16). Park et al. (17) reported that microRNA-449a knockdown results in protective effects, downregulating catabolic genes and restoring the expression of anabolic genes, via SIRT1 in IL-1β-associated cartilage degeneration. MiRNAs are also found in immune cells, and may have critical functions in various immune responses. Zitzer et al. (18) reported that miR-155 expression is essential in the filtration of donor T cells into multiple target organs. Adoro et al. (19) reported that IL-21 directly inhibits human immunodeficiency virus (HIV)-1, and identified microRNA-29 as an antiviral molecule that is upregulated by IL-21 in helper T cells. However, the changes of miRNAs caused by IL-36β in CD8+ T cells have not been reported.
The present study assessed IL-36β at the protein and gene levels in pancreatic cancer and adjacent noncancerous tissue samples by immunohistochemistry and quantitative real-time polymerase chain reaction (PCR), respectively. Next, IL-36β’s anticancer activity was examined by establishing a mouse tumor model. The changes of cell populations in the TME were assessed by flow cytometry. In mechanistic studies, microarray assays showed that the miRNA let-7c-5p was consistently downregulated after induction by IL-36β of human and mouse CD8+ T cells. Furthermore, IL-36β was found to regulate the biological activity of CD8+ T cells by downregulating let-7c-5p, which is the innovation of this study. We present the following article in accordance with the ARRIVE reporting checklist (available at https://dx.doi.org/10.21037/atm-21-5991).
Methods
Specimens
The pancreatic cancer tissue samples were derived from cases confirmed by pathological findings that were surgically treated in the General Surgery Department of the First Affiliated Hospital, Soochow University. These patients received no adjuvant treatment preoperatively. The tumors were extracted, and paired adjacent noncancerous tissue samples from these cases were obtained simultaneously. The samples were stored at −80 °C for qRT-PCR detection, or underwent fixation with 10% formalin and paraffin embedding for immunohistochemistry.
Spleen surgical samples were obtained from three individuals who received splenectomy without spleen diseases in the above-mentioned hospital. C57BL/6 mice provided by the Jackson Laboratory (Shanghai) underwent housing in the specific pathogen-free facility of Soochow University. Fresh spleens from mice and humans were immediately treated, and purified CD8+ T cells were obtained using magnetic bead-based methods (Miltenyi Biotec, Auburn, CA, USA). The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee of The First Affiliated Hospital of Soochow University (approval No. 2015683). Informed consent was taken from all the patients.
Cell culture
Panc02 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) plus 10% fetal bovine serum (FBS) When cells reached approximately 30% confluency, appropriate amounts of IL-36β lentivirus (GeneChem Co., Shanghai) were used to transfect them according to a multiplicity of infection (MOI) of 10. Transfection of an empty vector was performed in the negative control group. After 24 hours of transfection, cell lines were selected using the medium containing 10 µg/mL puromycin.
Animals and tumor model establishment
BALB/c mice, provided by the Zhao Yan (Suzhou) New Drug Research Center, were housed in a pathogen-free facility at the Jiangsu Institute of Clinical Immunology, Soochow University. Animal experiments were performed under a project license (No. 2016597) granted by institutional ethics committee of Soochow University and in compliance with the guidelines of Institutional Animal Care and Use Committee of Soochow University (http://dwzx.suda.edu.cn/). Mouse pancreatic cancer cells were administered subcutaneously into BALB/c mice, and tumor sizes were examined every other day. The tumor diameter was derived according to the formula D = (L + W)/2 (mm), where L and W are length and width, respectively, to plot the tumor growth curve.
Tumor vaccination
Panc02 cells were administered by subcutaneous injection into BALB/c mice. On the 7th day, IL-36β adenovirus was injected in mouse tumors to observe its effect, monitoring the animals for tumor growth every 2 days.
Tumor-infiltrating lymphocyte (TIL) assessment
Each tumor was cut into 3–4 mm pieces and rinsed with Hank’s balanced salt solution (HBSS). Next, the pieces were digested with collagenase IV at 37 °C for 2 h and passed through a 40-mm cell strainer. TILs underwent further purification by Ficoll-Paque gradient centrifugation according to the manufacturer’s instructions, followed by washing and resuspension in HBSS with 1% FCS. Finally, flow cytometry was performed to detect cell populations on a FACS flow cytometer (BD Biosciences, San Diego, CA, USA).
Overexpression and interference lentiviral vectors
A pair of oligos (NP7179 and NP7180) were designed for gene synthesis according to the mmu-let-7c-5p (MIMAT0000523) mature body sequence (UGAGGUAGGUUGUAUGGUU) (Table 1). After annealing into double-stranded DNA, the lentiviral backbone vector PDS134_pL_shRNA_mKate2 (enzyme cutting site, BsmBI) was generated. The mmu-let-7c-5p overexpression lentiviral vector was constructed and confirmed by sequencing, and the constructed vector was named let-7c-5p+. The interference lentiviral vector was constructed by the same method, and named let-7c-5p−. The oligo sequences are shown in Table 1.
Table 1
Name | Sequence, 5'-3' |
---|---|
Overexpression | |
Mmu-let-7c-5p-F | CACCGTGAGGTAGTAGGTTGTATGGTTCGAAAACCATACAACCTACTACCTCA |
Mmu-let-7c-5p-R | AAAATGAGGTAGTAGGTTGTATGGTTTTCGAACCATACAACCTACTACCTCAC |
Interference | |
Mmu-let-7c-5p-TUD-F | CAACAACCATACAACCGATCTACTACCTCA |
Mmu-let-7c-5p-TUD-R | CTTGTGAGGTAGTAGATCGGTTGTATGGTT |
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells using TRIzol according to the manufacturer’s instructions (ambion, USA). RNA quantitation was performed on a NanoDrop 2000 (Thermo Scientific, USA). Reverse transcription was carried out from 1.0 µg RNA with oligo-dT primers and avian myeloblastosis virus reverse transcriptase. Next, qRT-PCR was performed with SYBR Green Real-time PCR Master Mix (Invitrogen, USA) on a real-time PCR machine (ABI ViiA7 Sequence Detection System, Life Technologies, USA) to examine let-7c-5p, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for normalization. The primers are listed in Table 2. Amplification was carried out at 95 °C (15 s), followed by 45 cycles of 95 °C (5 s) and 60 °C (30 s). The 2−ΔΔCt method was utilized for data analysis in triplicate assays.
Table 2
Primer name | Sequence, 5'-3' |
---|---|
Q-mmu-let-7c-5p-RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACCATAC |
Q-mmu-let-7c-5p-F | ACACTCCAGCTGGGTGAGGTAGTAGGTTGT |
Q-mmu-let-7c-5p-R | TGGTGTCGTGGAGTCG |
GAPDH-F | TGACTTCAACAGCGACACCCA |
GAPDH-R | CACCCTGTTGCTGTAGCCAAA |
qRT-PCR, quantitative real-time PCR.
Microarray analysis
Naive CD8+ T cells, obtained from spleens of human and mice, were cultured with medium alone or medium containing IL-36β (100 ng/mL) for 48 h. The above two groups of cells were harvested separately, and their microRNA expression profiles were determined by microarray analysis (Agilent, USA). MicroRNAs with expression fold change ≥2 and P<0.05 were selected. A heat map was generated using R software with the pheatmap language package (https://www.bioconductor.org/).
Immunoblotting
Cell lysis was performed on ice. The bicinchoninic acid (BCA) method was used for protein quantitation. Equal amounts of total protein underwent separation by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), followed by electro-transfer onto polyvinylidene difluoride (PVDF) membranes. After blocking, primary antibodies were added for overnight incubation at 4 °C. This was followed by washing steps and incubation with secondary antibodies at room temperature for 2 h. An enhanced chemiluminescence (ECL) assay kit (Epizyme Biomedical Technology Co., Ltd., Shanghai) was used for development, and protein band intensities were semi-quantitatively assessed with Image J (NIH, USA). Triplicate assays were performed.
Immunohistochemistry
Paraffin-embedded clinical tissue samples sectioned at 4-µm underwent incubation with rabbit anti-human IL-36β polyclonal antibodies (1:400) overnight at 4 °C. IL-36β signals appeared as brown staining. The samples were scored based on cytoplasmic staining (0, 1, and 2 for no, weak, and strong signals, respectively) and positive area percentage (0, 1, and 2 for <10%, 10–50%, and >50%, respectively). The total score was the product of both subscores, and a value >1 was considered to indicate positive staining.
Enzyme-linked immunosorbent assays (ELISA)
Naive CD8+ T cells were initially administered anti-CD3 mAb or anti-CD28 mAb (2.5/1.25 µg/mL). Subsequently, IFN-γ and IL-2 levels were assessed using specific human and mouse ELISA kits (ExCell Bio, China) according to the manufacturer’s instructions.
Statistical analysis
The Student’s t-test, the Mann-Whitney test, or one-way analysis of variance (ANOVA) were carried out for data analysis as indicated. Two-sided unpaired P<0.05 indicated statistical significance.
Results
IL-36β is downregulated in cancer tissues
IL-36β amounts in 40 pairs of pancreatic cancer and paracancerous tissue specimens were examined by qRT-PCR and immunohistochemical staining. As shown in Figure 1A, IL-36β mRNA levels in paracancerous tissue specimens were 3.8 times those of cancer tissue samples. Immunohistochemical staining revealed that IL-36β was mainly localized in the cytoplasm of pancreatic cancer cells (Figure 1B). The positive expression rates for the IL-36β protein were 40% and 75% in cancer and paracancerous tissue specimens, respectively, indicating a statistically significant difference (χ2=10.026, P<0.05; Table 3). This suggested that IL-36β may be critical in the development of pancreatic cancer.
Table 3
Tissue | Cases | Positive | Negative | χ2 | P |
---|---|---|---|---|---|
Cancer tissue | 40 | 16 | 24 | 10.026 | <0.05 |
Paracancerous tissue | 40 | 30 | 10 |
IL, interleukin.
High IL-36β expression inhibits tumor growth
To further clarify IL-36β’s function in the TME, we stably transfected Panc02 cells with IL-36β overexpression lentivirus and performed in vivo experiments in mice to assess IL-36β’s effects on tumor growth after overexpression in the TME. Panc02 pancreatic cancer cells were subcutaneously transplanted into the left abdomen of mice; after 3 days, soybean sized-nodules were detected. There were differences in growth rate among the three transplanted tumor groups from the beginning of tumorigenesis. The IL-36β group initially grew rapidly, which may be due to inflammatory reactions caused by the proinflammatory cytokine IL-36β, resulting in tissue edema and increased tumor size. However, with prolonged observation time, the tumor size in the Panc02-IL-36β group began to lag behind those of the Panc02-negative control (NC) and Panc02-Control groups. Until the end of the study, the tumor diameter was markedly reduced in the Panc02-IL-36β group compared with the other two groups (Figure 2). The above findings indicated that IL-36β overexpression inhibited tumor growth in the mouse subcutaneous xenograft model.
IL-36β overexpression elevates the levels of CD8+ T and NK cells
To explore the basic mechanism by which IL-36β exerts anticancer effects, we examined the changes of TILs in the tumor by flow cytometry. First, the percentage of CD45+ cells in tumor single cell suspensions was markedly elevated in the Panc02-IL-36β group compared with the blank and negative control groups (Figure 3A), suggesting that IL-36β increased the inflammatory response in the tumor. It is known that type 1 lymphocytes, such as CD8+ T and NK cells, have the ability to inhibit tumor cells in tumor immunity. Therefore, we quantified various types of CD45+ TILs, CD8+ T cells, and NK cells. The results revealed that the levels of CD8+ T cell were higher in the Panc02-IL-36β group compared to the other two control groups. Meanwhile, there was no significant difference in the NK cell content between the IL-36β group and both control groups. However, due to the increase of CD45+ TILs in the tumor, the total NK cell levels were also elevated (Figure 3B,3C). These findings suggested that overexpression of IL-36β increases CD45+ TILs as well as anti-tumor effector cells, including CD8+ T and NK cells.
Adenovirus with IL-36β overexpression reduces tumor growth after intratumoral injection
The previous experiments basically demonstrated that high expression of IL-36β in the TME can promote CD8+ T and NK cell aggregation to exert anti-tumor effects and inhibit tumor growth. We hypothesized that tumor immunogenicity can be increased by intratumoral injection of IL-36β adenovirus, recruiting immune cells to inhibit tumor growth. Mice were subcutaneously transplanted with wild-type Panc02 cells and randomized into three groups of five. Tumor growth was comparable in all groups in the first week. On the 7th day, the three groups of mice were injected separately with IL-36β overexpression adenovirus, adenovirus empty vector, and phosphate-buffered saline (PBS). Afterwards, the tumor growth rates in different groups varied. Until the end of the study, the tumor size was markedly reduced in mice injected with IL-36β adenovirus compared with the control (PBS and adenovirus empty vector) groups (Figure 4).
Adenovirus with IL-36β overexpression causes CD8+ T, NK, and γδT cell aggregation
To further analyze the effect of intratumoral injection of adenovirus expressing IL-36β on the TME, the changes of TILs were assessed by flow cytometry. The results showed that the percentage of CD45+ TILs was markedly elevated in the IL-36β adenovirus group compared with the negative and blank control groups (Figure 5A). In addition, the IL-36β adenovirus group showed increased CD8+ T cell content compared with the two control groups. NK cell contents in the IL-36β and both control groups were comparable, but the total NK cell number was increased in the IL-36β adenovirus group due to increased CD45+ TILs in the tumor. The IL-36β group had reduced γδT cell content compared with both control groups, but the total γδT cells were also increased in the tumor, given that the CD45+ TILs in the IL-36β group were increased by approximately two-fold (Figure 5B,5C). Together, the above findings suggested that adenovirus expressing IL-36β can be used as an immune enhancer to induce the accumulation of CD8+ T, NK, and γδT cells in the cancer microenvironment and exert antitumor effects.
Reduced let-7c-5p expression after IL-36β treatment stimulates effector CD8+ T cells
Naive CD8+ T cells were obtained from spleens of humans and mice by magnetic bead-based assays (Miltenyi Biotec). The effector CD8+ T cell culture was performed with medium alone or medium containing IL-36β (100 ng/mL) for 48 h. The above two groups of cells were harvested separately, and the microRNA expression profiles were determined by microarray analysis (Figure 6A,6B). Twenty-one miRNAs were changed in both humans and mice (Table 4). Subsequently, the changes in miRNA and mRNA expression levels were detected by qRT-PCR [including wild type (WT) CD8+ and WT CD8+/IL36β stimulation]. As shown in Figure 6C, let-7c-5p downregulation was the most consistent. Therefore, we proposed the hypothesis that IL-36β regulates the biological function of CD8+ T cells by downregulating let-7c-5p.
Table 4
miRNA |
let-7a-2-3p |
let-7c-5p |
miR-122-3p |
miR-126a-3p |
miR-144-3p |
miR-145a-3p |
miR-192-5p |
miR-200c-3p |
miR-212-3p |
miR-219b-5p |
miR-221-5p |
miR-24-2-5p |
miR-29b-1-5p |
miR-301a-3p |
miR-302a-3p |
miR-331-3p |
miR-494-5p |
miR-532-5p |
miR-542-3p |
miR-615-3p |
miR-98-5p |
Successful generation of let-7c-5p overexpression and let-7c-5p RNAi lentiviruses
Mmu-let-7c-5p overexpression and RNA interfere (RNAi) lentiviral vectors were successfully constructed. Thus, mmu-let-7c-5p overexpression lentivirus (let-7c-5p+) and mmu-let-7c-5p RNAi lentivirus (let-7c-5p−) were successfully prepared. QRT-PCR showed mmu-let-7c-5p upregulation after transfection of the overexpression lentivirus let-7c-5p+ into the target cells (Figure 7A). The luciferase assay showed that the mmu-let-7c-5p RNAi vector successfully downregulated mmu-let-7c-5p (Figure 7B).
Downregulation of mmu-let-7c-5p upregulates IFN-γ and IL-2 in CD8+ T cells, whereas its upregulation exerts the opposite effect
Naive CD8+ T cells were firstly administered anti-CD3 mAb and anti-CD28 mAb at 2.5 and 1.25 µg/mL, respectively. Next, the above mmu-let-7c-5p constructs (let-7c-5p+ and let-7c-5p−) were respectively transfected into mouse CD8+ T cells; negative lentivirus transfection was performed in the control group. Subsequently, cell supernatants were collected for IFN-γ and IL-2 detection by ELISA. IKappaBbeta (IK-B) protein amounts were assessed by immunoblotting. In this study, downregulation of mmu-let-7c-5p increased the levels of IFN-γ and IL-2 in CD8+ T cells, and its upregulation had the opposite effect (Figure 8A,8B). Western blotting detected no significant changes in IK-B protein levels (Figure 8C).
IL-36β downregulates IFN-γ in let-7c-5p+ CD8+ T cells
To further explore the link between IL-36β and let-7c-5p, we divided the cells into four groups, including the control, IL-36β, IL-36β + let-7c-5p+, and IL-36β + NC groups. All CD8+ T cells in the above four groups were administered anti-CD3 mAb (2.5 µg/mL) and anti-CD28 mAb (1.25 µg/mL). Next, IFN-γ was detected by ELISA, and the results showed IL-36β upregulated IFN-γ in CD8+ T cells. Interestingly, IL-36β decreased the levels of IFN-γ in the let-7c-5p+ group (Figure 9). Therefore, we speculated that IL-36β affected the function of let-7c-5p through a particular signaling pathway.
Discussion
As a proinflammatory cytokine, IL-36 is involved in many inflammatory reactions and plays an active role in immunity. Therefore, excessive IL-36 levels often means that the body has a certain degree of damage (20). Previous reports on IL-36 have mostly assessed its involvement in various chronic inflammatory and immuno-pathological processes mediated by Th2 cells, including psoriasis, rheumatoid arthritis, inflammatory colorectal diseases, etc. (21-23). Recent evidence suggests that IL-36 also promotes CD4+ T cell-dependent type 1 immune reactions. Binding to the mouse bone marrow-derived dendritic cell (BMDC) surface receptor IL-36R, IL-36β upregulates CD80, CD86, and MHC-II molecules, and stimulates the activation of CD4+ T cells and splenocytes to synthesize IFN-γ, IL-4, and IL-17 (10). IL-36 directly acts on CD4+ T cells to increase cell division and IL-2 secretion; in addition, IL-36 synergizes with IL-12 in promoting Th1 polarization of naive CD4+ T cells (8).
The present study revealed that IL-36β was markedly downregulated in pancreatic cancer tissue samples compared with adjacent tissue specimens, which indicates that IL-36β has a potential function in antitumor immunity and may be related to tumor progression. This might be because IL-36β is mainly secreted by immune cells. However, tumor cells are predominant in the microenvironment of tumor tissues, and immune effector cells are in an immunosuppressive state, resulting in fewer immune cells infiltrating; therefore, tumor IL-36β levels are reduced compared with normal tissues. The above mouse experiments illustrated that tumor IL-36β overexpression inhibited tumor growth, and IL-36β exerted antitumor effects by inducing the proliferation of CD8+ T and NK cells in the TME. To further validate the antitumor effect of IL-36β, we transfected tumor cells in vivo with IL-36β adenovirus to increase the levels of IL-36β in tumors, and found that the IL-36β overexpression adenovirus could act as an immunopotentiator to induce CD8+ T, NK, and γδT cell aggregation in the TME, thereby exerting antitumor effects.
As shown above, IL-36β stimulated CD8+ T cells to synthesize high IFN-γ and IL-2 amounts. Microarray analysis showed that after IL-36β stimulation of human and mouse CD8+ T cells, let-7c-5p levels were decreased consistently. Subsequently, the expression of let-7c-5p in mouse CD8+ T cells was respectively increased and decreased by the lentiviral technique. It was found that let-7c-5p silencing increased IFN-γ and IL-2 synthesis by CD8+ T cells. Meanwhile, when IL-36β was used to stimulate CD8+ T cells, these effects were further enhanced. High expression of let-7c-5p yielded the opposite results. These findings indicate IL-36β promotes the production of IFN-γ and IL-2 by downregulating let-7c-5p in CD8+ T cells. Therefore, we hypothesized that IL-36β affects the function of let-7c-5p through a particular signaling pathway.
The let-7 family was one of the first miRNA groups to be found in Caenorhabditis elegans in 2000 (24). The human let-7 family consists of 13 miRNAs, including let-7c. Several reports have indicated let-7c is a tumor suppressor that is downregulated or absent in multiple human tumors, including lung, ovarian, prostate, and colon cancers (25,26). Let-7c-5p, which belongs to the 1et-7 family, also has an anticancer function. New research has shown that CDKN2B antisense RNA 1 (CDKN2B-AS1), an oncogenic long noncoding RNA (lncRNA) of hepatocellular carcinoma (HCC), promotes the nucleosome assembly proteins 1-like 1 protein (NAP1L1)-dependent phosphatidylinositol-3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) pathway by sponging let-7c-5p (27). Zhao et al. (12) also found IL-36β promotes CD8+ T cell activation by inducing mammalian target of rapamycin complex 1 (mTORC1) via PI3K/Akt, IκB kinase (IKK), and myeloid differentiation factor 88 (MyD88) signaling, thus enhancing antitumor immune responses. Fu et al. (28) found that let-7c-5p decreases cell proliferation and enhances apoptosis via excision repair cross complementing 6 (ERCC6) in breast cancer. Wells et al. (29) unveiled a new let-7-dependent mechanism acting as a molecular brake to control the degree of CD8+ T cell responses. Mao et al. (30) reported that long noncoding RNA GM16343 promotes IL-36β to regulate tumor microenvironment by CD8+ T cells. As shown above, IL-36β increased IFN-γ and IL-2 levels by downregulating let-7c-5p in CD8+ T cells, which has not been previously reported. In summary, direct and indirect experiments have confirmed that IL-36β enhances the anti-tumor effects of CD8+ T cells by downregulating let-7c-5p.
Interestingly, this study found that IL-36β overexpression inhibited tumor growth in the mouse subcutaneous xenograft model, but the role of IL-36β in pancreatic cancer tumorigenesis has not been reported. Pan et al. (31) investigated the expression, prognostic value, and the underlying antitumor mechanism of IL-36α in hepatocellular carcinoma (HCC), found that IL-36α expression and overall patient survival, concomitant with a negative correlation with tumor size, degree of differentiation, and tumor growth.
Current cancer treatments include surgery, chemotherapy, and radiotherapy. With in-depth assessment of tumor etiology and immune responses, tumor immunotherapy has become the fourth treatment modality (32). Programmed death 1 (PD-1) monoclonal antibody therapy has had great success in clinical practice for the treatment of melanoma (33). However, the response to this treatment approach for other solid tumors may be limited since it relies on the response of spontaneous T cells to the malignancy. It is known that some cytokines can enhance tumor immunogenicity, thereby helping active lymphocytes or reversing their incompetent state, so as to ultimately exert anti-tumor effects. This study suggests that IL-36β has an anti-tumor activity, and let-7c-5p plays an important role in IL-36β-induced CD8+ T cell-mediated immune response; however, the specific mechanism requires further investigated experimentally.
Conclusions
Our findings suggest that IL-36β promotes IFN-γ and IL-2 production in CD8+ T cells, and IL-36β promotes anti-tumor effects in CD8+ T cells by downregulating the micro-RNA let-7c-5p.
Acknowledgments
Funding: This study was supported by grants from the National Science Foundation of China (NSFC, No. 31770985, No. 82073180); the Jiangsu Provincial Key Research and Development Program, China (No. BE2019665); the Jiangsu Provincial Medical Youth Talent, China (No. QNRC2016732); Suzhou Municipal Project of Gusu Health Talent, Young Top Talent, China (No. 2018-057); the Gusu Health Talents Cultivation Program, China (No. GSWS2019028); the Scientific Research Program of Jiangsu Provincial “333 Projects”, China (No. BRA2019327); and the Science and Technology Program of Suzhou City, China (No. SYS2019053, No. SLC201906).
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://dx.doi.org/10.21037/atm-21-5991
Data Sharing Statement: Available athttps://dx.doi.org/10.21037/atm-21-5991
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://dx.doi.org/10.21037/atm-21-5991). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. For human research, the study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study was approved by the ethics committee of The First Affiliated Hospital of Soochow University (approval No. 2015683). Informed consent was taken from all the patients. Animal experiments were performed under a project license (No. 2016597) granted by institutional ethics committee of Soochow University and in compliance with the guidelines of Institutional Animal Care and Use Committee of Soochow University (http://dwzx.suda.edu.cn/).
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Baitsch L, Fuertes-Marraco SA, Legat A, et al. The three main stumbling blocks for anticancer T cells. Trends Immunol 2012;33:364-72. [Crossref] [PubMed]
- Pan H, Yu T, Sun L, et al. LncRNA FENDRR-mediated tumor suppression and tumor-immune microenvironment changes in non-small cell lung cancer. Transl Cancer Res 2020;9:3946-59. [Crossref]
- Yi JS, Cox MA, Zajac AJ. T-cell exhaustion: characteristics, causes and conversion. Immunology 2010;129:474-81. [Crossref] [PubMed]
- Nagtegaal ID, Marijnen CA, Kranenbarg EK, et al. Local and distant recurrences in rectal cancer patients are predicted by the nonspecific immune response; specific immune response has only a systemic effect--a histopathological and immunohistochemical study. BMC Cancer 2001;1:7. [Crossref] [PubMed]
- Gao X, Wang X, Yang Q, et al. Tumoral expression of IL-33 inhibits tumor growth and modifies the tumor microenvironment through CD8+ T and NK cells. J Immunol 2015;194:438-45. [Crossref] [PubMed]
- Hamanaka Y, Suehiro Y, Fukui M, et al. Circulating anti-MUC1 IgG antibodies as a favorable prognostic factor for pancreatic cancer. Int J Cancer 2003;103:97-100. [Crossref] [PubMed]
- Ngo VL, Kuczma M, Maxim E, et al. IL-36 cytokines and gut immunity. Immunology 2021;163:145-54. [Crossref] [PubMed]
- Vigne S, Palmer G, Martin P, et al. IL-36 signaling amplifies Th1 responses by enhancing proliferation and Th1 polarization of naive CD4+ T cells. Blood 2012;120:3478-87. [Crossref] [PubMed]
- Mutamba S, Allison A, Mahida Y, et al. Expression of IL-1Rrp2 by human myelomonocytic cells is unique to DCs and facilitates DC maturation by IL-1F8 and IL-1F9. Eur J Immunol 2012;42:607-17. [Crossref] [PubMed]
- Vigne S, Palmer G, Lamacchia C, et al. IL-36R ligands are potent regulators of dendritic and T cells. Blood 2011;118:5813-23. [Crossref] [PubMed]
- Wang X, Zhao X, Feng C, et al. IL-36γ Transforms the Tumor Microenvironment and Promotes Type 1 Lymphocyte-Mediated Antitumor Immune Responses. Cancer Cell 2015;28:296-306. [Crossref] [PubMed]
- Zhao X, Chen X, Shen X, et al. IL-36β Promotes CD8+ T Cell Activation and Antitumor Immune Responses by Activating mTORC1. Front Immunol 2019;10:1803. [Crossref] [PubMed]
- Ali Syeda Z, Langden SSS, Munkhzul C, et al. Regulatory Mechanism of MicroRNA Expression in Cancer. Int J Mol Sci 2020;21:1723. [Crossref] [PubMed]
- Chen LT, Xu SD, Xu H, et al. MicroRNA-378 is associated with non-small cell lung cancer brain metastasis by promoting cell migration, invasion and tumor angiogenesis. Med Oncol 2012;29:1673-80. [Crossref] [PubMed]
- Guo B, Liu L, Yao J, et al. miR-338-3p suppresses gastric cancer progression through a PTEN-AKT axis by targeting P-REX2a. Mol Cancer Res 2014;12:313-21. [Crossref] [PubMed]
- Shi Y, Luo X, Li P, et al. miR-7-5p suppresses cell proliferation and induces apoptosis of breast cancer cells mainly by targeting REGγ. Cancer Lett 2015;358:27-36. [Crossref] [PubMed]
- Park KW, Lee KM, Yoon DS, et al. Inhibition of microRNA-449a prevents IL-1β-induced cartilage destruction via SIRT1. Osteoarthritis Cartilage 2016;24:2153-61. [Crossref] [PubMed]
- Zitzer NC, Snyder K, Meng X, et al. MicroRNA-155 Modulates Acute Graft-versus-Host Disease by Impacting T Cell Expansion, Migration, and Effector Function. J Immunol 2018;200:4170-9. [Crossref] [PubMed]
- Adoro S, Cubillos-Ruiz JR, Chen X, et al. IL-21 induces antiviral microRNA-29 in CD4 T cells to limit HIV-1 infection. Nat Commun 2015;6:7562. [Crossref] [PubMed]
- Mattii M, Ayala F, Balato N, et al. The balance between pro- and anti-inflammatory cytokines is crucial in human allergic contact dermatitis pathogenesis: the role of IL-1 family members. Exp Dermatol 2013;22:813-9. [Crossref] [PubMed]
- Miyachi H, Wakabayashi S, Sugihira T, et al. Keratinocyte IL-36 Receptor/MyD88 Signaling Mediates Malassezia-Induced IL-17-Dependent Skin Inflammation. J Infect Dis 2021;223:1753-65. [Crossref] [PubMed]
- Lamacchia C, Palmer G, Rodriguez E, et al. The severity of experimental arthritis is independent of IL-36 receptor signaling. Arthritis Res Ther 2013;15:R38. [Crossref] [PubMed]
- Boutet MA, Bart G, Penhoat M, et al. Distinct expression of interleukin (IL)-36α, β and γ, their antagonist IL-36Ra and IL-38 in psoriasis, rheumatoid arthritis and Crohn's disease. Clin Exp Immunol 2016;184:159-73. [Crossref] [PubMed]
- Reinhart BJ, Slack FJ, Basson M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000;403:901-6. [Crossref] [PubMed]
- Schubert M, Spahn M, Kneitz S, et al. Distinct microRNA expression profile in prostate cancer patients with early clinical failure and the impact of let-7 as prognostic marker in high-risk prostate cancer. PLoS One 2013;8:e65064. [Crossref] [PubMed]
- Dong H, Huang Z, Zhang H, et al. Rs13293512 polymorphism located in the promoter region of let-7 is associated with increased risk of radiation enteritis in colorectal cancer. J Cell Biochem 2018;119:6535-44. [Crossref] [PubMed]
- Huang Y, Xiang B, Liu Y, et al. LncRNA CDKN2B-AS1 promotes tumor growth and metastasis of human hepatocellular carcinoma by targeting let-7c-5p/NAP1L1 axis. Cancer Lett 2018;437:56-66. [Crossref] [PubMed]
- Fu X, Mao X, Wang Y, et al. Let-7c-5p inhibits cell proliferation and induces cell apoptosis by targeting ERCC6 in breast cancer. Oncol Rep 2017;38:1851-6. [Crossref] [PubMed]
- Wells AC, Daniels KA, Angelou CC, et al. Modulation of let-7 miRNAs controls the differentiation of effector CD8 T cells. Elife 2017;6:26398. [Crossref] [PubMed]
- Mao D, Hu C, Zhang J, et al. Long Noncoding RNA GM16343 Promotes IL-36β to Regulate Tumor Microenvironment by CD8+ T cells. Technol Cancer Res Treat 2019;18:1533033819883633. [Crossref] [PubMed]
- Pan QZ, Pan K, Zhao JJ, et al. Decreased expression of interleukin-36α correlates with poor prognosis in hepatocellular carcinoma. Cancer Immunol Immunother 2013;62:1675-85. [Crossref] [PubMed]
- Ribas A. Tumor immunotherapy directed at PD-1. N Engl J Med 2012;366:2517-9. [Crossref] [PubMed]
- Topalian SL, Hodi FS, Brahmer JR, et al. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. N Engl J Med 2012;366:2443-54. [Crossref] [PubMed]
(English Language Editor: A. Kassem)