The long non-coding RNA CRNDE promotes osteosarcoma proliferation and migration by sponging miR-136-5p/MRP9 axis
Introduction
Osteosarcoma (OS) is a malignant bone tumor, which mostly occurs in children and adolescents. It is rare with an approximate incidence of 30 per million although occurs anywhere, about 75% are located in the extremities (most commonly in the thigh) and 10% each in the trunk wall and retroperitoneum (1). Previously, the 5-year survival rate of surgery was below 30%, but now, through the combination of neoadjuvant chemotherapy, surgical resection, adjuvant chemotherapy, targeted therapy, and immunotherapy, the 5-year survival rate of OS patients has increased up to 70%. However, lung metastasis is still a primary factor affecting the prognosis of OS patients (2,3). Moreover, heterogeneity of OS may partly influences patients’ response to treatment drugs. And there is currently no standard salvage treatment as third-line chemotherapy for OS patients after the failure of second-line therapy. Thus, it is necessary to explore the mechanisms that mediate the invasion and metastasis of OS and more effective therapeutic regimens, which can inhibit its progress and improve the clinical prognosis.
The DNA able to encode proteins comprise only a small portion of the genome. 98% of the DNA transcription products are non-coding RNA (ncRNA), which are divided into short-chain (<200 nt) and long-chain ncRNA (>200 nt) based on their length. Since the discovery of lncRNA, its relevance to diseases, especially tumors, has received increasing attention (4). The lncRNA titin antisense RNA 1(TTN-AS1) regulates OS cell apoptosis and drug resistance through the miR-134-5p/MBTD1 axis (5). The lncRNA SNHG3 can regulate the miRNA-151a-3p/RAB22A axis to affect the invasion and migration of OS (6). Besides, lncRNA SNHG4 can promote the proliferation and migration of OS by sponging and absorbing miR-377-3p (7). The above outcomes indicate that lncRNA is involved in the occurrence and development of OS. The CRNDE gene was originally found in colorectal cancer (CRC) tissue. It is located on chromosome 16 and has a length of 1,059 bp (8). A study showed that knockout of CRNDE upregulates miR-136-5p, inhibit cell proliferation, and promote apoptosis (9). It has been reported that lncRNA CRNDE can promote the proliferation, migration, and invasion of hepatocellular carcinoma cells by inhibiting miR-384 (10). Another study reported that lncRNA CRNDE can serve as molecular sponge of microRNA-136 in mammary cancer to activate the Wnt/β-catenin signaling pathway (11); knockdown of CRNDE inhibited cell proliferation, migration, and invasion of ovarian cancer (12). Moreover, lncRNA CRNDE can also be applied as a biomarker for clear cell renal cell carcinoma and glioma in patients (13,14). The above findings suggest the correlation between lncRNA CRNDE and tumors. However, the effect of lncRNA CRNDE on OS remains unclear.
Many studies have revealed that lncRNAs can directly bind to microRNAs (miRNAs) and regulate their activities as competitive endogenous RNAs (ceRNAs). Multitude of studies have confirmed the complicated cross-regulation among lncRNA, miRNA, and messenger RNA (mRNA), as well as the potential regulatory effect of lncRNA-miRNA-mRNA axis on OS (15). For example, Jing et al. found that CRNDE can promote the advance of non-small cell lung cancer by regulating miRNA-338-3p (16). Ma et al. revealed that HOTAIR has a carcinogenic effect on gallbladder carcinoma through the negative regulation of miR-130a (17). Nevertheless, the impact of lncRNA CRNDE targeting miRNA in OS requires further investigation. Osteosarcoma is a rare disease, which only scratches a little interest of researchers. The studies associated with lncRNAs are still less comparing with other common tumors. Here, we first proposed lncRNA CRNDE was the key factor to modulate the expression of MRP9 through sponging miR-136-5p. As soon as this relationship was disturbed, the invasion and proliferation capacity of OS cells was decreased significantly. Furthermore, MRP9, a drug resistance-related protein, is rarely been regards as an oncogenic protein in research. But our study proved its key function in the OS progression, which provides a new underling target for OS treatment. We present the following article in accordance with the MDAR reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-3602/rc).
Methods
Clinical samples
This study included 45 patients treated in our hospital from January 2015 to July 2018. Both OS tumor tissue samples and corresponding normal tissues were collected from these patients. All patients signed informed consent, and this study was approved by the Ethics Committee of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital (No. 2017-049-1). The research was conducted in accordance with the World Medical Association Declaration of Helsinki (as revised in 2013).
Cell culture and cell transfection
The OS cells lines MG63 and 143B were obtained from the Chinese Academy of Sciences (Beijing, China). Cells were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA) in a humidified atmosphere containing 5% CO2 at 37 ℃. The full-length lncRNA CRNDE sequence was inserted into pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO vector (OE-CRNDE, Hanbio, Shanghai, China); the short hairpin RNAs (shRNAs) for lncRNA CRNDE were ligated into pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector (shCRNDE#1, shCRNDE#2, shCRNDE#3, Hanbio, Shanghai, China); and corresponding negative controls were constructed (OE-NC, sh-NC). The miR-136-5p mimic and its negative control (NC) were purchased from Ruibo (Guangzhou, China). Cells were transfected according to the Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) manufacturer’s instructions. After 6 hours of transfection, supernatants were removed and fresh medium replaced, cells were subsequently rested for 48 hours. The stably transfected cells were selected with 2 µg/mL puromycin (Sigma-Aldrich, St. Louis, MO, USA).
Dual-Luciferase reporter assay
The mutant vector was designed by mutating the putative binding site of miR-136 on lncRNA CRNDE and MRP9. MG63 cells were co-transfected with wild-type vector or mutant vector along with miR-136 mimic or NC mimics. After 48 hours, we detected luciferase activity through dual-luciferase reporter assay system (Promega, Madison, WI, USA).
Cell proliferation assay
Cells were seeded at a density of 5×103 cells/cm2 into the 96-well plates. Cell Counting Kit-8 (CCK-8) was added and incubated with cells according to the instructions of the CCK-8 kit (Dojindo, Kumamoto, Japan). The absorbance was measured at 450 nm with a microplate reader (Biotek, Winooski, USA).
Wound-healing assay
Cells were seeded into 6-well plates and cultured overnight. The wounds were scratched with a 200 µL pipette tip. Subsequently, the cells were washed with phosphate-buffered saline (PBS) to remove the suspending cells and cultured continuously. After 24 hours, the wounds were imaged using a microscope (Olympus, Tokyo, Japan).
Transwell assay
Membranes of Transwell plates were covered with diluted Matrigel (Corning Inc., Corning, NY, USA), and in the upper chamber of each well 5×104 cells were seeded with serum-free DMEM. In the lower chamber of each well, DMEM with 10% FBS was added. After 24 hours of incubation, the cells on the upper chamber were removed, the membrane was fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet for 20 minutes. The invading cells were counted in 5 random fields under a microscope (Olympus, Tokyo, Japan).
Quantitative reverse transcription polymerase chain reaction
The RNA and miRNA of the cells was extracted by using Trizol reagent (Invitrogen, Carlsbad, CA, USA) or miRcute miRNA Isolation Kit (TIANGEN, Beijing, China). The RNA was reverse transcribed into complementary DNA (cDNA) by using the PrimeScriptTM RT reagent kit (Perfect Real Time, Takara, Shiga, Japan) or miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN, China). Then, polymerase chain reaction (PCR) amplification of the synthesized cDNA was executed with SYBR Green qPCR Mix kit (Takara, Japan) or miRcute Plus miRNA qPCR Kit (SYBR Green, TIANGEN, China. The PCR analysis was performed to assess the levels of lncRNA CRNDE, miR-136-5p, and MRP9. Their relative expression was analyzed by the 2−ΔΔCT method and normalized to the control condition. Primers sequences are shown in the Table 1.
Table 1
| Gene name | Primer sequences |
|---|---|
| CRNDE | F: 5'-AAATTCATCCCAAGGC-3' |
| R: 5'-TTCCAGTGGCATCCTC-3' | |
| miR-136-5p | F: 5'-ACTCCATTTGTTTTGATGATGGA-3' |
| R: 5'-GTGCAGGGTCCGAGGTATTC-3' | |
| F: 5'-CAGGAAGGAACCGTGAC-3' | |
| R: 5'-TCCGTGAGCCCTTGTC-3' | |
| U6 | F: 5'-CTCGCTTCGGCAGCACA-3' |
| R: 5'-AACGCTTCACGAATTTGCGT-3' | |
| β-actin | F: 5'-CATGTACGTTGCTATCCAGGC-3' |
| R: 5'-CTCCTTAATGTCACGCACGAT-3' |
Western blot analysis
The protein of cells was extracted by using lysis buffer (Biyuntian, Ningxia, China) containing protease inhibitors. The concentration of protein was quantified with a bicinchoninic acid (BCA) protein assay kit (CoWin Biosciences (Cwbio), Jiangsu, China). The proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skim milk and incubated with MRP9 antibody (1:1,000, Biorbyt Ltd., Cambridgeshire, UK) at 4 ℃ overnight. After washing with tris-buffered saline with Tween 20 (TBST), the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 2 hours at room temperature (1:1,000, Solarbio, Beijing, China). The bands were visualized by chemiluminescence reagent kit (Thermo Fisher Scientific, Waltham, MA, USA).
In situ hybridization
The matched OS and normal tissue samples were obtained from the Oncology Department of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. The expression of CRNDE was detected by CRNDE probe (tactggctattggaaggaggagattctgaagataa) and evaluated with the POD Kit (Bioster, Hubei, China). All procedures were performed by following the manufacturer’s instructions. Brownish yellow particles were considered as positive staining.
Statistical analysis
All data were presented as the means ± SD and calculated using SPSS 24.0 (IBM Corp., Armonk, NY, USA). The t-test was used to analyze the differences between two groups, while more than two groups were compared by one-way ANOVA. The relationship between lncRNA CRNDE expression and clinicopathological features of OS patients were evaluated by the chi-square test. An overall survival curve was constructed by Kaplan-Meier method and significance was assessed by the log-rank test. A P value <0.05 was considered statistically significant.
Results
LncRNA CRNDE is upregulated in OS tissues and associates with poor prognosis of patients with OS
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis demonstrated that lncRNA CRNDE level was higher in OS tissues than that in normal tissues (Figure 1A).
Then, we classified patients into a high CRNDE group and low CRNDE group based on the median value of lncRNA CRNDE expression. In situ hybridization (ISH) revealed low lncRNA CRNDE expression in the normal tissues. Whereas there was some positive expression in the low CRNDE group, and a higher number of positive cells in the high CRNDE group (Figure 1B). As shown in Table 2, high lncRNA CRNDE level were correlated with clinical stage and pulmonary metastasis, whereas it did not correlate with age, gender, tumor size, necrosis rate, pathological type, or local recurrence. Kaplan-Meier survival analysis revealed that OS patients with higher lncRNA CRNDE expression had a shorter overall survival than those with lower CRNDE expression (Figure 1C). All of these findings indicate that lncRNA CRNDE expression associate with poor prognosis in OS patients.
Table 2
| Characteristics | CRNDE expression | P value | |
|---|---|---|---|
| Low level [27] | High level [18] | ||
| Gender | 0.619 | ||
| Male | 10 | 8 | |
| Female | 17 | 10 | |
| Age (years) | 0.464 | ||
| <15 | 7 | 3 | |
| ≥15 | 20 | 15 | |
| Tumor size (cm) | 0.465 | ||
| ≤10 | 15 | 8 | |
| >10 | 12 | 10 | |
| Clinical stage | 0.001 | ||
| II | 23 | 6 | |
| III | 4 | 12 | |
| Necrosis rate | 0.519 | ||
| ≤90% | 17 | 13 | |
| >90% | 10 | 5 | |
| Pathological type | 0.761 | ||
| Conventional | 22 | 14 | |
| Non-conventional | 5 | 4 | |
| Pulmonary metastasis | 0.001 | ||
| Negative | 23 | 7 | |
| Positive | 4 | 11 | |
| Local recurrence | 0.329 | ||
| Negative | 26 | 16 | |
| Positive | 1 | 2 | |
OS, osteosarcoma.
LncRNA CRNDE binds miR-136-5p directly
The potential lncRNAs-miRNAs interaction was predicted by ENCORI (https://starbase.sysu.edu.cn). We found that miR-136-5p complementarily combined with lncRNA CRNDE (Figure 2A). To confirm the interaction between lncRNA CRNDE and miR-136-5p, we designed dual-luciferase system containing the binding sequences of miR-136-5p with lncRNA CRNDE. The results showed that miR-136-5p overexpression decreased the luciferase activity of CRNDE-WT but not that of CRNDE-MUT (Figure 2B), which confirmed the potential interaction between lncRNA CRNDE and miR-136-5p. We transfected lentiviral vectors into MG63 cells and 143B cells. The down-regulation of lncRNA CRNDE was acquired by transiently transfecting lncRNA CRNDE shRNAs into the cells (shCRNDE#1,2,3). As shCRNDE#2 had the most efficacy in suppressing lncRNA CRNDE expression, and it was selected for the subsequent experiments (Figure 2C). Next, the miR-136-5p expression in OS cells transfected with vectors were detected. Overexpression of lncRNA CRNDE could notably reduce the miR-136-5p level in cells (Figure 2D). The above results suggest that lncRNA CRNDE can target miR-136-5p expression in OS.
Overexpression of miR-136-5p can reduce the promotion of OS cells proliferation and migration by overexpression of lncRNA CRNDE
The effect of lncRNA CRNDE on OS cell proliferation and invasion and the role of miR-136-5p were further investigated. As shown in Figure 3A-3C, overexpression of lncRNA CRNDE could accelerate cell proliferation, migration, and invasion; silencing lncRNA CRNDE could suppress cell proliferation, migration, and invasion; while co-transfection with miR-136 mimic reversed the promoting function of lncRNA CRNDE overexpressed cells. Globally, lncRNA CRNDE markedly promotes malignant progression of OS cells, while miR-136-5p blocks this effect.
LncRNA CRNDE upregulates MRP9 through inhibiting miR-136-5p
By using TargetScan 7.0 (www.targetscan.org/vert_70/), we found that miR-136-5p target MRP9 has a binding site in the 3'-untranslated region (3'-UTR) region of the MRP9 gene (Figure 4A). This observation was confirmed through a dual luciferase assay containing the miR-136 binding sites on the MRP9 3'UTR (Figure 4B). Results showed that miR-136-5p overexpression decreased the luciferase activity in the MRP-WT construct, but not in the case of MRP-MUT. As expected, the mRNA and protein levels of MRP9 were increased after lncRNA CRNDE overexpression and decreased after the silencing on this lncRNA. However, co-transfection with the miR-136 mimic reversed the high expression of MRP9 in lncRNA CRNDE-overexpressed cells (Figure 4C,4D). In conclusion, lncRNA CRNDE targets miR-136-5p expression and regulates MRP9 expression, thereby exerting a tumor-promoting effect.
Discussion
In recent years, the importance of lncRNA in numerous diseases has been gradually recognized; lncRNAs can also be used as markers of tumor prognosis. Many lncRNAs have been found to be abnormally expressed in OS. Multiple studies have verified the oncogenic function of lncRNA CRNDE in a variety of cancers (18). Wang et al. reported that CRNDE played an oncogenic role in cell proliferation and metastasis of pancreatic cancer through upregulating IRS1 (19). In this study, we demonstrate that lncRNA CRNDE is significantly upregulated in OS patients, and its high expression is associated with poorer patient prognosis. Besides, overexpression of lncRNA CRNDE promotes the proliferation, migration, and invasion of OS cells.
Not only lncRNA can activate or inhibit target gene expression by directly binding to it, but it also participates in the regulation of gene expression by partaking in histone modification or recruiting transcription factors (20). In addition, lncRNA can be used as a ceRNA to bind to miRNA, and regulate the downstream genes (21). Hu et al. reported that CRNDE acted as a growth-promoting lncRNA in gastric cancer cells through targeting miR-145 (22). Also, CRNDE was found to promote progression of glioma through regulating the miR-384/PIWIL4/STAT3 axis (23). In CRC, CRNDE was particularly upregulated and interacted with miR-181a-5p to accelerate CRC cell proliferation and chemoresistance via activation of the Wnt/β-catenin signaling (24). In this study, lncRNA CRNDE targets miR-136-5p expression in OS, and overexpression of miR-136-5p reverses the promotion effect of lncRNA CRNDE overexpression on OS cell malignant process.
Many studies have shown that miR-136-5p is a tumor suppressor. Yan et al. (25) found that miR-136 was low-expressed in triple-negative breast cancer tissues. After over-expression miR-136 in cells, it could significantly inhibit tumor cell migration by inhibiting the RASAL2 gene. Yang et al. (26) reported that miR-136 inhibited glioma cell proliferation and induced apoptosis by regulating AEG-1 and Bcl-2 gene expression. Zhao et al. (27) showed that inhibiting miR-136 expression would up-regulate its target AEG-1 gene and could significantly improve the metastatic ability of liver cancer cells. The suppressive effect of miR-136 in lung cancer cells has also been confirmed (28). In this study, we find that miR-136-5p targets and binds to MRP9, regulating its expression.
The member of the ATP-binding cassette (ABC) superfamily, MRP9, located at 16q12.1. It was first cloned in 2003 by Shimizu et al. (29). The ABC superfamily is one of the largest protein families. It involves the transmembrane transport of various substrates, including the ability to use the energy of ATP hydrolysis to transport drugs from the cytoplasm to the outside of the cell (30). Therefore, most studies have been related to tumor treatment and drug resistance (31). However, a study pointed that MRP9 is abnormally up-regulated in breast cancer tissues (32), while its expression in liver cancer tissues is also significantly higher than in adjacent tissues (33). In this study, we show that overexpression of lncRNA CRNDE increases MRP9 level in OS cells, but lncRNA CRNDE overexpression combined with miR-136-5p mimic mostly reverses MRP9 expression. Collectively, all data suggest that lncRNA CRNDE upregulates the expression of MRP9 through binding to miR-136-5p.
Osteosarcoma is a heterogeneous mesenchymal malignancy. Despite combining surgery and chemotherapy as the standard of treatment, the overall survival rate of OS patients with recurrence or metastasis is still not encouraging, partly owing to heterogeneous histological and drug resistance. It is urgent to seek novel therapies to enhance the efficacy of the current treatment strategies. CRNDE is extremely abundant in the sections from 45 OS cases. Kapalan-Meier survival analysis showed that CRNDE was a significantly poorer prognosis. Our study suggests that CRNDE could be developed as a potential prognostic biomarker for OS. Moreover, we proved CRNDE served as an endogenous sponge to reduce miR-136-5p expression by binding to it directly, which regulating the expression of downstream targets MRP9 indirectly. Regrettably, although current several studies have proved that lncRNAs play key role in the occurrence and progression of tumors, providing new directions for early diagnosis, prognosis, and therapeutic targets of tumors. Owing to its diagnostic specificity and actual clinical value, lncRNAs have not yet been included in real-world study.
Conclusions
In summary, this study demonstrates lncRNA CRNDE can play an oncogenic role in OS, and promote OS progression through competitively binding with miR-136-5p to regulate MRP9 expression. Therefore, CRNDE is proposed to be a potential target for the OS therapy.
Acknowledgments
The authors appreciate the academic support from the AME Oncology Collaborative Group.
Funding: This work was supported by Talent Project of the Shanghai Jiao Tong University Affiliated Sixth People’s Hospital (No. ynlc201603), the Interdisciplinary Program of Shanghai Jiao Tong University (No. YG2017GN19), research grants from the British Heart Foundation (BHF) Centre of Research Excellence, Oxford (N.A. RE/13/1/30181 and RE/18/3/34214, to Naveed Akbar).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://atm.amegroups.com/article/view/10.21037/atm-22-3602/rc
Data Sharing Statement: Available at https://atm.amegroups.com/article/view/10.21037/atm-22-3602/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-3602/coif). NA received research grants from the British Heart Foundation (BHF) Centre of Research Excellence, Oxford (N.A. RE/13/1/30181 and RE/18/3/34214). The other authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The Ethics Committee of the Shanghai Jiao Tong University Affiliated Sixth People’s Hospital approved the present study (No. 2017-049-1). The research was conducted in accordance with the World Medical Association Declaration of Helsinki (as revised in 2013). All patients provided written informed consent before their inclusion to the study.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Mehren MV, Kane JM, Bui MM, et al. NCCN Guidelines Insights: Soft Tissue Sarcoma, Version 1.2021: Featured Updates to the NCCN Guidelines. Journal of the National Comprehensive Cancer Network 2020;18:1604-12. [Crossref]
- Ferrari S, Serra M. An update on chemotherapy for osteosarcoma. Expert Opin Pharmacother 2015;16:2727-36. [Crossref] [PubMed]
- Bielack SS, Kempf-Bielack B, Delling G, et al. Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols. J Clin Oncol 2002;20:776-90. [Crossref] [PubMed]
- International Human Genome Sequencing Consortium. Finishing the euchromatic sequence of the human genome. Nature 2004;431:931-45. [Crossref] [PubMed]
- Fu D, Lu C, Qu X, et al. LncRNA TTN-AS1 regulates osteosarcoma cell apoptosis and drug resistance via the miR-134-5p/MBTD1 axis. Aging (Albany NY) 2019;11:8374-85. [Crossref] [PubMed]
- Zheng S, Jiang F, Ge D, et al. LncRNA SNHG3/miRNA-151a-3p/RAB22A axis regulates invasion and migration of osteosarcoma. Biomed Pharmacother 2019;112:108695. [Crossref] [PubMed]
- Huang YF, Lu L, Shen HL, et al. LncRNA SNHG4 promotes osteosarcoma proliferation and migration by sponging miR-377-3p. Mol Genet Genomic Med 2020;8:e1349. [Crossref] [PubMed]
- Graham LD, Pedersen SK, Brown GS, et al. Colorectal Neoplasia Differentially Expressed (CRNDE), a Novel Gene with Elevated Expression in Colorectal Adenomas and Adenocarcinomas. Genes Cancer 2011;2:829-40. [Crossref] [PubMed]
- Liu C, Liu B, Shen C, et al. lncRNA CRNDE promotes proliferation and inhibits apoptosis of U937 cells by downregulating miR-136-5p and upregulating MCM5. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2021;37:987-95. [PubMed]
- Chen Z, Yu C, Zhan L, et al. LncRNA CRNDE promotes hepatic carcinoma cell proliferation, migration and invasion by suppressing miR-384. Am J Cancer Res 2016;6:2299-309. [PubMed]
- Huan J, Xing L, Lin Q, et al. Long noncoding RNA CRNDE activates Wnt/β-catenin signaling pathway through acting as a molecular sponge of microRNA-136 in human breast cancer. Am J Transl Res 2017;9:1977-89. [PubMed]
- Wang Q, Wang LX, Zhang CY, et al. LncRNA CRNDE promotes cell proliferation, migration and invasion of ovarian cancer via miR-423-5p/FSCN1 axis. Mol Cell Biochem 2022;477:1477-88. [Crossref] [PubMed]
- Ding C, Han F, Xiang H, et al. LncRNA CRNDE is a biomarker for clinical progression and poor prognosis in clear cell renal cell carcinoma. J Cell Biochem 2018;119:10406-14. [Crossref] [PubMed]
- Jing SY, Lu YY, Yang JK, et al. Expression of long non-coding RNA CRNDE in glioma and its correlation with tumor progression and patient survival. Eur Rev Med Pharmacol Sci 2016;20:3992-6. [PubMed]
- Wang JY, Yang Y, Ma Y, et al. Potential regulatory role of lncRNA-miRNA-mRNA axis in osteosarcoma. Biomed Pharmacother 2020;121:109627. [Crossref] [PubMed]
- Jing H, Xia H, Qian M, et al. Long noncoding RNA CRNDE promotes non-small cell lung cancer progression via sponging microRNA-338-3p. Biomed Pharmacother 2019;110:825-33. [Crossref] [PubMed]
- Ma MZ, Li CX, Zhang Y, et al. Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer. Mol Cancer 2014;13:156. [Crossref] [PubMed]
- Zhang J, Yin M, Peng G, et al. CRNDE: An important oncogenic long non-coding RNA in human cancers. Cell Prolif 2018;51:e12440. [Crossref] [PubMed]
- Wang G, Pan J, Zhang L, et al. Long non-coding RNA CRNDE sponges miR-384 to promote proliferation and metastasis of pancreatic cancer cells through upregulating IRS1. Cell Prolif 2017;50:e12389. [Crossref] [PubMed]
- Mengelbier LH, Karlsson J, Lindgren D, et al. Deletions of 16q in Wilms tumors localize to blastemal-anaplastic cells and are associated with reduced expression of the IRXB renal tubulogenesis gene cluster. Am J Pathol 2010;177:2609-21. [Crossref] [PubMed]
- Das S, Ghosal S, Sen R, et al. lnCeDB: database of human long noncoding RNA acting as competing endogenous RNA. PLoS One 2014;9:e98965. [Crossref] [PubMed]
- Hu CE, Du PZ, Zhang HD, et al. Long Noncoding RNA CRNDE Promotes Proliferation of Gastric Cancer Cells by Targeting miR-145. Cell Physiol Biochem 2017;42:13-21. [Crossref] [PubMed]
- Zheng J, Liu X, Wang P, et al. CRNDE Promotes Malignant Progression of Glioma by Attenuating miR-384/PIWIL4/STAT3 Axis. Mol Ther 2016;24:1199-215. [Crossref] [PubMed]
- Han P, Li JW, Zhang BM, et al. The lncRNA CRNDE promotes colorectal cancer cell proliferation and chemoresistance via miR-181a-5p-mediated regulation of Wnt/β-catenin signaling. Mol Cancer 2017;16:9. [Crossref] [PubMed]
- Yan M, Li X, Tong D, et al. miR-136 suppresses tumor invasion and metastasis by targeting RASAL2 in triple-negative breast cancer. Oncol Rep 2016;36:65-71. [Crossref] [PubMed]
- Yang Y, Wu J, Guan H, et al. MiR-136 promotes apoptosis of glioma cells by targeting AEG-1 and Bcl-2. FEBS Lett 2012;586:3608-12. [Crossref] [PubMed]
- Zhao J, Wang W, Huang Y, et al. HBx elevates oncoprotein AEG-1 expression to promote cell migration by downregulating miR-375 and miR-136 in malignant hepatocytes. DNA Cell Biol 2014;33:715-22. [Crossref] [PubMed]
- Yang Y, Liu L, Cai J, et al. Targeting Smad2 and Smad3 by miR-136 suppresses metastasis-associated traits of lung adenocarcinoma cells. Oncol Res 2013;21:345-52. [Crossref] [PubMed]
- Shimizu H, Taniguchi H, Hippo Y, et al. Characterization of the mouse Abcc12 gene and its transcript encoding an ATP-binding cassette transporter, an orthologue of human ABCC12. Gene 2003;310:17-28. [Crossref] [PubMed]
- Kaur H, Lakatos-Karoly A, Vogel R, et al. Coupled ATPase-adenylate kinase activity in ABC transporters. Nat Commun 2016;7:13864. [Crossref] [PubMed]
- König J, Hartel M, Nies AT, et al. Expression and localization of human multidrug resistance protein (ABCC) family members in pancreatic carcinoma. Int J Cancer 2005;115:359-67. [Crossref] [PubMed]
- Bera TK, Iavarone C, Kumar V, et al. MRP9, an unusual truncated member of the ABC transporter superfamily, is highly expressed in breast cancer. Proc Natl Acad Sci U S A 2002;99:6997-7002. [Crossref] [PubMed]
- Slot AJ, Molinski SV, Cole SP. Mammalian multidrug-resistance proteins (MRPs). Essays Biochem 2011;50:179-207. [Crossref] [PubMed]
(English Language Editor: J. Jones)

